ID: 1052163962

View in Genome Browser
Species Human (GRCh38)
Location 9:25299048-25299070
Sequence TTGGATGCTTACTATGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052163962_1052163967 25 Left 1052163962 9:25299048-25299070 CCTTGCCCATAGTAAGCATCCAA No data
Right 1052163967 9:25299096-25299118 AATGAATGAATGGCAGCTTCAGG No data
1052163962_1052163966 15 Left 1052163962 9:25299048-25299070 CCTTGCCCATAGTAAGCATCCAA No data
Right 1052163966 9:25299086-25299108 TAACTGAATAAATGAATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052163962 Original CRISPR TTGGATGCTTACTATGGGCA AGG (reversed) Intergenic
No off target data available for this crispr