ID: 1052165136

View in Genome Browser
Species Human (GRCh38)
Location 9:25317347-25317369
Sequence CTTTAGGAGGAGCTCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052165127_1052165136 13 Left 1052165127 9:25317311-25317333 CCGGTACCAGTTTTTCCTTTCCA No data
Right 1052165136 9:25317347-25317369 CTTTAGGAGGAGCTCATGGAGGG No data
1052165128_1052165136 7 Left 1052165128 9:25317317-25317339 CCAGTTTTTCCTTTCCATGTTTA 0: 251
1: 4600
2: 1950
3: 701
4: 910
Right 1052165136 9:25317347-25317369 CTTTAGGAGGAGCTCATGGAGGG No data
1052165130_1052165136 -7 Left 1052165130 9:25317331-25317353 CCATGTTTACTGCTTCCTTTAGG No data
Right 1052165136 9:25317347-25317369 CTTTAGGAGGAGCTCATGGAGGG No data
1052165129_1052165136 -2 Left 1052165129 9:25317326-25317348 CCTTTCCATGTTTACTGCTTCCT 0: 57
1: 4717
2: 4020
3: 1947
4: 1177
Right 1052165136 9:25317347-25317369 CTTTAGGAGGAGCTCATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052165136 Original CRISPR CTTTAGGAGGAGCTCATGGA GGG Intergenic
No off target data available for this crispr