ID: 1052169739

View in Genome Browser
Species Human (GRCh38)
Location 9:25378021-25378043
Sequence ATCAGGTTAGCTAGGACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052169739_1052169746 28 Left 1052169739 9:25378021-25378043 CCACCAGTCCTAGCTAACCTGAT No data
Right 1052169746 9:25378072-25378094 GAGCTAGTCATTTAATTAATGGG No data
1052169739_1052169745 27 Left 1052169739 9:25378021-25378043 CCACCAGTCCTAGCTAACCTGAT No data
Right 1052169745 9:25378071-25378093 TGAGCTAGTCATTTAATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052169739 Original CRISPR ATCAGGTTAGCTAGGACTGG TGG (reversed) Intergenic
No off target data available for this crispr