ID: 1052170810 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:25394222-25394244 |
| Sequence | CTGTGGATATGGAGAGCCAA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1052170805_1052170810 | 8 | Left | 1052170805 | 9:25394191-25394213 | CCACAGTTGGTTGAATCTACAGA | 0: 2 1: 39 2: 143 3: 271 4: 528 |
||
| Right | 1052170810 | 9:25394222-25394244 | CTGTGGATATGGAGAGCCAACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1052170810 | Original CRISPR | CTGTGGATATGGAGAGCCAA CGG | Intergenic | ||
| No off target data available for this crispr | |||||