ID: 1052170810

View in Genome Browser
Species Human (GRCh38)
Location 9:25394222-25394244
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052170805_1052170810 8 Left 1052170805 9:25394191-25394213 CCACAGTTGGTTGAATCTACAGA 0: 2
1: 39
2: 143
3: 271
4: 528
Right 1052170810 9:25394222-25394244 CTGTGGATATGGAGAGCCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052170810 Original CRISPR CTGTGGATATGGAGAGCCAA CGG Intergenic
No off target data available for this crispr