ID: 1052174726

View in Genome Browser
Species Human (GRCh38)
Location 9:25444172-25444194
Sequence CTGTTGGTATGTTGTAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052174723_1052174726 9 Left 1052174723 9:25444140-25444162 CCGATGATTTTAAAACATAAATT 0: 2
1: 0
2: 5
3: 118
4: 1084
Right 1052174726 9:25444172-25444194 CTGTTGGTATGTTGTAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052174726 Original CRISPR CTGTTGGTATGTTGTAAAAA AGG Intergenic
No off target data available for this crispr