ID: 1052174726 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:25444172-25444194 |
| Sequence | CTGTTGGTATGTTGTAAAAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1052174723_1052174726 | 9 | Left | 1052174723 | 9:25444140-25444162 | CCGATGATTTTAAAACATAAATT | 0: 2 1: 0 2: 5 3: 118 4: 1084 |
||
| Right | 1052174726 | 9:25444172-25444194 | CTGTTGGTATGTTGTAAAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1052174726 | Original CRISPR | CTGTTGGTATGTTGTAAAAA AGG | Intergenic | ||
| No off target data available for this crispr | |||||