ID: 1052178556

View in Genome Browser
Species Human (GRCh38)
Location 9:25496353-25496375
Sequence CAGTACAAAGCAGTTCCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052178552_1052178556 21 Left 1052178552 9:25496309-25496331 CCGGCTGTGCTGAGCTATCATGG No data
Right 1052178556 9:25496353-25496375 CAGTACAAAGCAGTTCCTCTAGG No data
1052178551_1052178556 30 Left 1052178551 9:25496300-25496322 CCTTTCTTTCCGGCTGTGCTGAG No data
Right 1052178556 9:25496353-25496375 CAGTACAAAGCAGTTCCTCTAGG No data
1052178554_1052178556 -3 Left 1052178554 9:25496333-25496355 CCAATTTTATTCCAGTTGCACAG No data
Right 1052178556 9:25496353-25496375 CAGTACAAAGCAGTTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052178556 Original CRISPR CAGTACAAAGCAGTTCCTCT AGG Intergenic
No off target data available for this crispr