ID: 1052186132

View in Genome Browser
Species Human (GRCh38)
Location 9:25596520-25596542
Sequence TTTCTTCAACAGATAGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052186132_1052186134 5 Left 1052186132 9:25596520-25596542 CCCAACACTATCTGTTGAAGAAA No data
Right 1052186134 9:25596548-25596570 CTTTCTCTATTGTTTATTCTTGG No data
1052186132_1052186135 17 Left 1052186132 9:25596520-25596542 CCCAACACTATCTGTTGAAGAAA No data
Right 1052186135 9:25596560-25596582 TTTATTCTTGGCATCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052186132 Original CRISPR TTTCTTCAACAGATAGTGTT GGG (reversed) Intergenic
No off target data available for this crispr