ID: 1052191312

View in Genome Browser
Species Human (GRCh38)
Location 9:25666231-25666253
Sequence TCACCATTTAACTTTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052191312_1052191316 10 Left 1052191312 9:25666231-25666253 CCTCCTTTAAAGTTAAATGGTGA No data
Right 1052191316 9:25666264-25666286 TTGTACTGACAGAACGTGAGGGG No data
1052191312_1052191315 9 Left 1052191312 9:25666231-25666253 CCTCCTTTAAAGTTAAATGGTGA No data
Right 1052191315 9:25666263-25666285 GTTGTACTGACAGAACGTGAGGG No data
1052191312_1052191314 8 Left 1052191312 9:25666231-25666253 CCTCCTTTAAAGTTAAATGGTGA No data
Right 1052191314 9:25666262-25666284 TGTTGTACTGACAGAACGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052191312 Original CRISPR TCACCATTTAACTTTAAAGG AGG (reversed) Intergenic
No off target data available for this crispr