ID: 1052192668

View in Genome Browser
Species Human (GRCh38)
Location 9:25677667-25677689
Sequence GCTGTAGCCGAGGCCGCAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 224}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052192668_1052192682 17 Left 1052192668 9:25677667-25677689 CCGGCTGCGGCCTCGGCTACAGC 0: 1
1: 0
2: 2
3: 20
4: 224
Right 1052192682 9:25677707-25677729 CGAGTCCCGGGAGCGGAGGCCGG 0: 1
1: 0
2: 1
3: 12
4: 187
1052192668_1052192679 10 Left 1052192668 9:25677667-25677689 CCGGCTGCGGCCTCGGCTACAGC 0: 1
1: 0
2: 2
3: 20
4: 224
Right 1052192679 9:25677700-25677722 AGGGCTCCGAGTCCCGGGAGCGG 0: 1
1: 0
2: 4
3: 17
4: 172
1052192668_1052192685 23 Left 1052192668 9:25677667-25677689 CCGGCTGCGGCCTCGGCTACAGC 0: 1
1: 0
2: 2
3: 20
4: 224
Right 1052192685 9:25677713-25677735 CCGGGAGCGGAGGCCGGAGTCGG 0: 1
1: 0
2: 2
3: 24
4: 300
1052192668_1052192677 5 Left 1052192668 9:25677667-25677689 CCGGCTGCGGCCTCGGCTACAGC 0: 1
1: 0
2: 2
3: 20
4: 224
Right 1052192677 9:25677695-25677717 CCCAGAGGGCTCCGAGTCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 227
1052192668_1052192686 24 Left 1052192668 9:25677667-25677689 CCGGCTGCGGCCTCGGCTACAGC 0: 1
1: 0
2: 2
3: 20
4: 224
Right 1052192686 9:25677714-25677736 CGGGAGCGGAGGCCGGAGTCGGG 0: 1
1: 0
2: 0
3: 27
4: 307
1052192668_1052192673 -9 Left 1052192668 9:25677667-25677689 CCGGCTGCGGCCTCGGCTACAGC 0: 1
1: 0
2: 2
3: 20
4: 224
Right 1052192673 9:25677681-25677703 GGCTACAGCCAGGGCCCAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 277
1052192668_1052192675 4 Left 1052192668 9:25677667-25677689 CCGGCTGCGGCCTCGGCTACAGC 0: 1
1: 0
2: 2
3: 20
4: 224
Right 1052192675 9:25677694-25677716 GCCCAGAGGGCTCCGAGTCCCGG 0: 1
1: 0
2: 0
3: 23
4: 157
1052192668_1052192672 -10 Left 1052192668 9:25677667-25677689 CCGGCTGCGGCCTCGGCTACAGC 0: 1
1: 0
2: 2
3: 20
4: 224
Right 1052192672 9:25677680-25677702 CGGCTACAGCCAGGGCCCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 240
1052192668_1052192680 13 Left 1052192668 9:25677667-25677689 CCGGCTGCGGCCTCGGCTACAGC 0: 1
1: 0
2: 2
3: 20
4: 224
Right 1052192680 9:25677703-25677725 GCTCCGAGTCCCGGGAGCGGAGG 0: 1
1: 0
2: 1
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052192668 Original CRISPR GCTGTAGCCGAGGCCGCAGC CGG (reversed) Exonic
900113779 1:1020196-1020218 GCGGCAGCAGCGGCCGCAGCGGG - Exonic
900171968 1:1273709-1273731 GCCGTAGTCGAGGCCGGAGCAGG + Exonic
900257602 1:1705185-1705207 GGTGTTGCCGAGACCTCAGCTGG - Intronic
900314895 1:2051611-2051633 GCTGTAGCTGAGGACGCACCGGG - Intronic
900500137 1:3000346-3000368 GCTGTAGACTTGGCAGCAGCAGG + Intergenic
900571069 1:3358483-3358505 GCTGCATCCGAAGCCGCGGCTGG - Intronic
902992251 1:20196455-20196477 GCTGAGGCCCAGGCCTCAGCTGG - Intergenic
903220626 1:21867635-21867657 GCTGGAGCCGAGGGTGGAGCTGG - Intronic
903653011 1:24932475-24932497 CCTGCACCCGGGGCCGCAGCTGG - Intronic
904026238 1:27505324-27505346 GCAGAAGCTGAGGCTGCAGCTGG - Intergenic
904998623 1:34650758-34650780 GCTGGAGCTGAGGAAGCAGCAGG + Intergenic
905017312 1:34786487-34786509 GCTGTGGCTGTGGCTGCAGCTGG + Intronic
906140392 1:43530953-43530975 GCTGGAGCCGGAGCCGGAGCCGG - Exonic
906557443 1:46724780-46724802 GCTGGAGTGGAGGCTGCAGCTGG + Intergenic
906614562 1:47225560-47225582 GCTGTAACCGAGGCGGGCGCGGG + Exonic
907298677 1:53471591-53471613 GGTGAAGCCTAGGCCACAGCAGG - Intergenic
912993389 1:114510760-114510782 GCGGGAGCCGAGGCTGGAGCTGG + Exonic
914762538 1:150610748-150610770 GCTGTACCAGAGGCTGAAGCAGG - Intronic
918497420 1:185156552-185156574 GCTGGAGCCGAGGCCGGAGTCGG + Exonic
920161982 1:204005609-204005631 GCAGAAGGCGAGGCTGCAGCAGG - Intergenic
920219884 1:204389226-204389248 GCTGTTGCCCAGGCTGGAGCTGG + Intergenic
920504746 1:206507845-206507867 GCTGCAGACCAGGCCGGAGCGGG - Exonic
921466772 1:215497676-215497698 GCAGCAGCAGAGGCAGCAGCAGG + Intergenic
1064662062 10:17616933-17616955 GCTGTCGCCGCGGCCACCGCCGG - Intronic
1065880507 10:30033779-30033801 CCTGCAGCCCAGGCCCCAGCAGG - Intronic
1068669539 10:59709619-59709641 GCAGGGGCCGGGGCCGCAGCTGG - Exonic
1074503100 10:114043895-114043917 GCTGGAGCCGCTGCCGCTGCTGG - Intergenic
1075306674 10:121374233-121374255 GCTGTGGCCGAGGACAGAGCAGG + Intergenic
1076116858 10:127907068-127907090 GCTGGAGCCGAGGCGGCGGCGGG + Exonic
1076119696 10:127925661-127925683 ACTGTTGCAGAGGCCACAGCTGG - Intronic
1076850012 10:133088114-133088136 GCTGTGGCCGAAGCGGCTGCCGG - Exonic
1076916013 10:133423461-133423483 GCTGCCGCCGGGGCGGCAGCCGG - Exonic
1077072461 11:682085-682107 GCAGCAGCCGAGGCCGCCCCAGG - Intronic
1077137149 11:1006185-1006207 GCTGTAGCCCAGCCTGCAGACGG + Intronic
1077213337 11:1383433-1383455 GCAGCAGCGGAGGCCGCGGCCGG + Intergenic
1077495512 11:2884906-2884928 ACTGGAGCCGGGGCCGGAGCCGG + Exonic
1079772464 11:24479455-24479477 GCTGTAGCTGAAGCCTCAGCAGG + Intergenic
1081938002 11:46918159-46918181 GCTGGAGCCGGGGCCGCTCCGGG + Intronic
1083169521 11:60914597-60914619 GCTCGAGCCGAGGCTGCAGGAGG - Intronic
1083762362 11:64825640-64825662 GCTGTAGACGTGGCTGCAGGGGG + Intronic
1085315339 11:75541473-75541495 GCTGGAGCCCAGGCAGCAGATGG - Intergenic
1085321279 11:75575530-75575552 GCTGTCGCAGAGGTCACAGCTGG - Intergenic
1088614866 11:111615104-111615126 ACTGTAGCCTAGGCCACAGAGGG + Intronic
1089255169 11:117190309-117190331 GCTGGAGCTGAGGCTGCGGCAGG - Intronic
1090252119 11:125258891-125258913 GCTGAGGCTGAGGCTGCAGCAGG - Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1095038459 12:37419249-37419271 GCTGCAGCCGAGGCGGCAGCTGG + Intergenic
1095049499 12:37543696-37543718 GCTGCCGCGGAGGCTGCAGCAGG + Intergenic
1096788315 12:54030346-54030368 CCTGGAGCAGAGGCCCCAGCAGG - Exonic
1099202160 12:79690200-79690222 GCTGCCGCCGAGGCCGCTGCTGG + Exonic
1103329494 12:120144337-120144359 GCTCTAGCTGGGGCAGCAGCAGG + Exonic
1103534760 12:121626825-121626847 GCCGGAGCCGCCGCCGCAGCGGG + Exonic
1105410547 13:20168035-20168057 GCTGAAGGTGAGGCCTCAGCTGG - Intergenic
1105477437 13:20740340-20740362 GAGGTGGCCGAGGCCGAAGCCGG - Intronic
1106720077 13:32427766-32427788 GCTGGGGCCGGGGCCGCGGCAGG + Intronic
1109867983 13:68291342-68291364 GCTGTAGCTGTGGCAGTAGCTGG - Intergenic
1112050621 13:95641776-95641798 GCTGTGGCCGCCGCCGCCGCGGG - Exonic
1112580371 13:100672969-100672991 CCTGTAGCAGAGGCCACAGTGGG - Intronic
1114316072 14:21511139-21511161 GCTGCAGCGGAGGCGGAAGCAGG - Exonic
1114473949 14:22981527-22981549 GCTCTAGCCGGGGCCGGAGTGGG - Exonic
1116437546 14:44912118-44912140 GGACTGGCCGAGGCCGCAGCCGG + Intergenic
1116991846 14:51285477-51285499 GCTATGGCTGAGGCTGCAGCTGG - Intergenic
1121355075 14:93207295-93207317 GCCGGAGCCGAGGGCGCCGCTGG + Exonic
1121819658 14:96956108-96956130 GGTGTAGCCCAGCCCACAGCTGG - Intergenic
1122315734 14:100825205-100825227 TCCGGAGCCGAGGCCGCGGCAGG + Intergenic
1122357661 14:101133242-101133264 GCTGTGGCTGAGGCCGGACCAGG - Intergenic
1122399544 14:101458712-101458734 GCTGTCGCCGAGGCCGCGGGGGG - Intergenic
1124971184 15:34490700-34490722 GCTGGAGCAGAGGCAGCAGCGGG - Intergenic
1127871633 15:63079028-63079050 GCTGGAGTCCAGGCCGGAGCAGG - Intergenic
1129710771 15:77819341-77819363 GCGGGAACCGAGGCCGGAGCGGG - Intronic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1132915197 16:2340369-2340391 CCCGGAGCCGAGGCCGCGGCAGG + Intronic
1136024845 16:27462714-27462736 GCTGTAACTGAGGCCTCAGTGGG + Intronic
1136366937 16:29813277-29813299 GCTGTTTCTGAGGCCCCAGCCGG - Exonic
1139364948 16:66427370-66427392 GCTGGAGCCGAAGCTGGAGCCGG + Exonic
1139509133 16:67416401-67416423 GCTGGAGCCGGAGCCGGAGCCGG - Exonic
1139952426 16:70678816-70678838 GCTGTAGGCCAGGCCACAGGGGG + Intronic
1142375976 16:89707354-89707376 GCTGCACCCCAGGCCCCAGCCGG + Exonic
1143026644 17:3945120-3945142 GTGGTAGCCGAGGCCGATGCGGG - Exonic
1143527196 17:7479534-7479556 GCTGGAGCCGGAGCCGGAGCTGG - Intronic
1145285967 17:21506168-21506190 GGTGCACCCGAGGCCCCAGCCGG + Intergenic
1145370126 17:22300791-22300813 GCTGTAACCTCGGCCGCGGCTGG - Intergenic
1145379006 17:22376854-22376876 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145379007 17:22376857-22376879 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145379484 17:22379224-22379246 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145379485 17:22379227-22379249 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145379963 17:22381594-22381616 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145379964 17:22381597-22381619 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145380444 17:22383969-22383991 GCTGCAGCCGCGGCTGCCGCTGG - Intergenic
1145380445 17:22383972-22383994 GCGGCAGCCGCGGCTGCAGCAGG + Intergenic
1145380921 17:22386316-22386338 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145380922 17:22386319-22386341 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145381401 17:22388691-22388713 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145381402 17:22388694-22388716 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145382134 17:22392465-22392487 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145382135 17:22392468-22392490 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145382609 17:22394830-22394852 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145382610 17:22394833-22394855 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145382889 17:22396193-22396215 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145382890 17:22396196-22396218 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145383462 17:22399016-22399038 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145383463 17:22399019-22399041 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145383976 17:22401484-22401506 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145383977 17:22401487-22401509 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145384414 17:22403686-22403708 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145384415 17:22403689-22403711 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145384733 17:22405148-22405170 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145384734 17:22405151-22405173 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1147162925 17:38578455-38578477 GCCGCAGCCGCAGCCGCAGCCGG + Intronic
1147630284 17:41925954-41925976 GCTGTACCAGAGGCCGAGGCAGG - Intronic
1148123356 17:45224802-45224824 GCTGTTGCTAAGGCAGCAGCCGG - Intronic
1148187905 17:45657789-45657811 GCTGTAGCTCAGGCCTCAGGAGG + Intergenic
1152201175 17:78947299-78947321 GCTGGAGCCGAGTCCAAAGCCGG - Intergenic
1152751540 17:82064787-82064809 GCTGTGGCCGCGGCCGCGGTTGG - Intronic
1153770585 18:8412428-8412450 GCTGTAGCCTAGGCAGCAGCAGG + Intergenic
1154309097 18:13253941-13253963 CCTAGAGCCGAGGCCGCAGAAGG + Intronic
1156019461 18:32583157-32583179 GCTATAGCGGCAGCCGCAGCAGG + Intergenic
1157473761 18:48008533-48008555 CCTGGAGCGGAGGCAGCAGCCGG - Intergenic
1159624062 18:70671074-70671096 GATGTAGCTGAAGCCTCAGCAGG - Intergenic
1159874951 18:73800622-73800644 GCAGCAGCAGAGGCAGCAGCTGG + Intergenic
1160510677 18:79451836-79451858 GCCGAAGCCCAGGCCGCAGATGG - Intronic
1160588735 18:79927895-79927917 GCTCTAGCTGAGGCGGCTGCAGG - Intronic
1160792617 19:929555-929577 GCTGTTGCAGCGGCAGCAGCGGG + Exonic
1160828590 19:1092016-1092038 GCGGAAGCCGAGGCCCGAGCAGG - Intronic
1161006051 19:1937359-1937381 CCTGTTGCTGAGGCCGCCGCGGG - Intergenic
1161571041 19:5031054-5031076 GAGGGAGCAGAGGCCGCAGCTGG - Intronic
1162261644 19:9538930-9538952 CCTGTGGGCGAGGCCGCAGCAGG + Intergenic
1162962549 19:14136497-14136519 GCTGTGGCGGAGGCCGCGCCTGG + Exonic
1163027082 19:14518587-14518609 GGTGTTGCCGAGGGCGGAGCGGG - Intronic
1164958396 19:32405968-32405990 GCTGTAGCCGAGGGTTCCGCCGG - Intronic
1165074151 19:33271469-33271491 GCTGGAGCAGAGGCGACAGCTGG + Intergenic
1165601639 19:37059249-37059271 GCTGCAGCCGCGGCGGCGGCTGG - Intronic
1165850915 19:38849900-38849922 GCTGGAGCAGAGGCAGCAGCCGG - Exonic
1166390699 19:42407393-42407415 GCTGTGGCCGCGCCCCCAGCAGG - Exonic
1166733647 19:45072034-45072056 GCTGGAGCCGCCGCCACAGCAGG - Exonic
1168293433 19:55368215-55368237 GCTGCAGCCGGCGCAGCAGCCGG + Exonic
931036658 2:58251596-58251618 GTTGTAGCCGATGCTGCCGCAGG - Intergenic
932720430 2:74134856-74134878 GTTGTAGCCATGGCTGCAGCAGG + Intronic
935223485 2:101034538-101034560 GCTACAGCCCAGGCCTCAGCGGG + Intronic
939683458 2:145168287-145168309 GCTGAAGCATCGGCCGCAGCTGG + Intergenic
942277926 2:174336249-174336271 GCTGGAGCCGAGGTTGCAGCTGG - Exonic
943393957 2:187308696-187308718 TCTGTAGCCCAGACCTCAGCAGG + Intergenic
945870161 2:215219008-215219030 GGGCTGGCCGAGGCCGCAGCTGG + Intergenic
946843247 2:223837791-223837813 GCTGCAGCCGAGGCGGGGGCGGG - Intronic
947741664 2:232487583-232487605 GCCGCAGCCGCAGCCGCAGCCGG + Intronic
948437981 2:237966961-237966983 GCGGCAGCCGAGACAGCAGCGGG - Intronic
948693803 2:239722690-239722712 GCTGTAGCAGAGGACACACCTGG + Intergenic
1170569544 20:17625128-17625150 GGTGTGGCCGAGGCCACACCAGG + Intronic
1171532491 20:25861773-25861795 GCTGCAGCCGCGGCGGCGGCTGG + Intronic
1171532823 20:25863430-25863452 GCTGCAGCCGCGGCGGCGGCTGG + Intronic
1171544029 20:25987198-25987220 GCTGCCGCGGAGGCTGCAGCAGG + Intergenic
1171941037 20:31330231-31330253 GTTGCAGCAGAGGCCTCAGCTGG - Intergenic
1174944713 20:54972097-54972119 GCTGTAGCTGTGGAAGCAGCTGG - Intergenic
1175863903 20:62164358-62164380 CCTGTAGCCCAGGCCTGAGCTGG - Intronic
1178175273 21:30089893-30089915 GCTGTAGCCAAGCCGGAAGCTGG - Intergenic
1180172513 21:46067131-46067153 GCTGGGGCCACGGCCGCAGCTGG + Intergenic
1180224774 21:46385894-46385916 GCTGCAGCAGAGGCGGGAGCGGG + Exonic
1181408443 22:22701647-22701669 GCTGTACCCCAGGCTGGAGCTGG - Intergenic
1183042975 22:35197240-35197262 GCTGTGGCCAAGGCCACAGAGGG + Intergenic
1183410239 22:37650658-37650680 GCTGGAGCCGGAGCCGGAGCCGG - Exonic
1184503628 22:44888456-44888478 GCTGTTTTCTAGGCCGCAGCAGG - Intronic
952316606 3:32238139-32238161 GCTCTGGCGGCGGCCGCAGCAGG + Intergenic
954109108 3:48424422-48424444 GCTGCAGCCCAGGGCTCAGCTGG + Exonic
954407059 3:50351053-50351075 GCTGTAACTGGGACCGCAGCAGG + Exonic
954423405 3:50430680-50430702 GCTGTAGACTAGGACCCAGCTGG + Intronic
955911611 3:63864056-63864078 GCTGCAGCCGGGGCCGCCGCCGG - Intergenic
956377718 3:68633789-68633811 GCTGTAGCTGTGGCCACAGTAGG + Intergenic
959056655 3:101574189-101574211 GCTGCAGGGGAGGCCGCGGCGGG + Exonic
959840576 3:110969613-110969635 GTTGTTGCCGCGGCCCCAGCAGG - Intergenic
961799968 3:129439983-129440005 GCTGTAGCCGAGGGGGCGGCCGG - Exonic
962837189 3:139199812-139199834 GCAGTAGCAGAGGCAGCAGCAGG + Intronic
963152915 3:142065545-142065567 GCTGTCGCCTAGGCTGGAGCAGG + Intronic
965644107 3:170861754-170861776 GCTGTCGCCCAGGCTGCAGGGGG + Intergenic
967248251 3:187510622-187510644 TCTGTAGCCCAGGCTGGAGCTGG - Intergenic
968618774 4:1594184-1594206 GCTGGAGGCGGGGCCGCTGCTGG - Intergenic
974854664 4:67446072-67446094 GCGGTAGCGGCGGCGGCAGCGGG - Intergenic
976199018 4:82561557-82561579 GCCGGGGCCGGGGCCGCAGCGGG + Intronic
980920914 4:139084467-139084489 GCTGTGGCGGCCGCCGCAGCTGG + Intronic
989567498 5:42915792-42915814 GCTGCAGCCCAGGCCGCCTCCGG + Intergenic
992102350 5:73419664-73419686 GCAGGAGGCGCGGCCGCAGCCGG + Intergenic
993900947 5:93584200-93584222 GCAGGAGTCGGGGCCGCAGCCGG - Exonic
994043468 5:95284148-95284170 GCTGCTCCCGAGGCCGCCGCGGG + Exonic
994620282 5:102154890-102154912 GGGCTGGCCGAGGCCGCAGCCGG + Intergenic
995263732 5:110135539-110135561 GCTGAAGCTGAGCCCACAGCTGG + Intergenic
997293980 5:132758474-132758496 GCTCTAGCGAAGGCCCCAGCCGG - Intronic
997585192 5:135039673-135039695 GCTGGATCCGGGGCCCCAGCCGG - Intronic
998295565 5:140966494-140966516 GCTGTAGCGGCAGCAGCAGCAGG + Exonic
998368478 5:141646158-141646180 ACTGGAGCAGAGGCGGCAGCAGG - Exonic
1002527118 5:179821033-179821055 GCGGAAGCCGAGGCTGCGGCGGG + Exonic
1005885011 6:30091066-30091088 GCTGGAGCAGAGGGAGCAGCGGG + Intergenic
1006421286 6:33935686-33935708 GCTGCAGCAGAGGCAGCTGCGGG + Intergenic
1007247837 6:40475160-40475182 GCTGGTGCCCAGGCTGCAGCTGG - Intronic
1007625405 6:43243676-43243698 GCCGCAGCCGCAGCCGCAGCGGG + Exonic
1009988106 6:70806194-70806216 GCTATAGCTGAGGCTTCAGCAGG - Intronic
1015732489 6:136362645-136362667 GCTGGGGCCGAGGCTGGAGCTGG + Exonic
1015732495 6:136362663-136362685 GCTGGGGCCGAGGCTGGAGCTGG + Exonic
1017497570 6:154995328-154995350 ACTGTGGCCGCGGCCGCCGCAGG + Intronic
1017638314 6:156465442-156465464 GCTGGAGCAGAGTCAGCAGCGGG + Intergenic
1018795507 6:167182149-167182171 GCCGCAGCCGCAGCCGCAGCAGG - Exonic
1018800658 6:167219690-167219712 GCTGTATCCCAGGCTGCAGAGGG - Intergenic
1018809500 6:167287617-167287639 GCTGTATCCCAGGCTGCAGAGGG + Intronic
1018820814 6:167372914-167372936 GCCGCAGCCGCAGCCGCAGCAGG + Exonic
1018937535 6:168283533-168283555 GCAGCAGCCGAGGACACAGCTGG + Intergenic
1019427385 7:984011-984033 GCTGTAGCCGAAGACGGATCAGG + Intronic
1020842117 7:13231457-13231479 GCTGCAGCAGAGTCCGCAGATGG + Intergenic
1021838862 7:24706304-24706326 GCTGAAGCCCCGGCAGCAGCAGG - Exonic
1022327452 7:29344990-29345012 GCTGTATCCCAGGACACAGCAGG - Intronic
1023300798 7:38768929-38768951 GCTGTAGCTGAGGCTGTAGCTGG - Intronic
1023932980 7:44717835-44717857 GCTGTTCCCGAGGCTGAAGCAGG + Intergenic
1025106444 7:56175127-56175149 GCAGAGGCCGAGGCCGGAGCAGG - Intergenic
1029402437 7:100354293-100354315 ACTCTAGCCCAGGCCACAGCAGG - Intronic
1031528949 7:122853399-122853421 GCTGTAGCTGAGTTCGCACCAGG + Intronic
1034193020 7:149225478-149225500 GCTGGGGCCGAGGCGGCACCAGG - Exonic
1034347646 7:150397195-150397217 CCTGCAGCCGGGGCCGCCGCGGG + Exonic
1034347847 7:150397995-150398017 GCTGAAGCCGCGGCCGCAGGCGG - Exonic
1035573196 8:687763-687785 GCCCTAGCCGAGGCCGTAGTAGG + Intronic
1037281434 8:17246752-17246774 GCGGTAGCGGCGGCGGCAGCGGG + Exonic
1037465158 8:19152525-19152547 GCTGTTGGCCAGGCCACAGCTGG + Intergenic
1042316800 8:67434709-67434731 GCTGCAGCAGTGGCAGCAGCAGG + Intronic
1045860512 8:106811091-106811113 GCTGGAGCAGAGGCCTCAGTGGG - Intergenic
1047726843 8:127691195-127691217 TCTGTCGCCGAGGCTGGAGCTGG - Intergenic
1049207771 8:141371394-141371416 GCTGTGGCCCTGGCCACAGCTGG + Intergenic
1049257951 8:141623893-141623915 GCTGTGGCCGAGGGAACAGCAGG - Intergenic
1049583084 8:143421519-143421541 GCTGGAGCCGAGGCCGGGCCAGG + Intronic
1049973543 9:841700-841722 GCTGCAGCCGGAGGCGCAGCTGG - Exonic
1050358405 9:4804618-4804640 GCTGTAGAGGAGGCCTCCGCCGG + Intronic
1051311616 9:15780065-15780087 GCAGTAACAGAGGCAGCAGCAGG + Intronic
1051471414 9:17447129-17447151 CCTGTAGCTGACACCGCAGCGGG - Intronic
1051665782 9:19465781-19465803 GCTGCAGCCGAGGCCACAGGAGG - Intergenic
1052192668 9:25677667-25677689 GCTGTAGCCGAGGCCGCAGCCGG - Exonic
1056243290 9:84669939-84669961 GGAGTAGCCGAGGCCGCCCCAGG - Intronic
1057489190 9:95508557-95508579 GCTGCGGCCGCGGCCGCTGCCGG + Exonic
1058764542 9:108168622-108168644 TCTGTAGCCCTGGCAGCAGCAGG - Intergenic
1059145547 9:111896673-111896695 GCTCTCGCCGGCGCCGCAGCGGG + Intergenic
1059335959 9:113568638-113568660 GCTGCAGCCCAAGCCGAAGCTGG + Intronic
1060945838 9:127569010-127569032 GCCGGAGCGGAAGCCGCAGCCGG - Exonic
1061989339 9:134149877-134149899 GCTGTGGCCGAGCTCGCTGCTGG - Intronic
1062107941 9:134765898-134765920 GCTGTAGACACGGCCCCAGCAGG + Intronic
1062209684 9:135356877-135356899 GCAGCAGCCAAGGCCTCAGCTGG + Intergenic
1062624185 9:137435537-137435559 GCTGTGGCCACGGCCGCAGCTGG - Intronic
1202629683 M:6249-6271 GCTATAGTGGAGGCCGGAGCAGG + Intergenic
1187281539 X:17861234-17861256 GCTGTCGCCGCCGCCGCTGCTGG + Exonic
1187507206 X:19887478-19887500 GCAGCAGCAGAGGCAGCAGCGGG - Exonic
1190785617 X:53645322-53645344 GTTGTAGCCGAGTTAGCAGCGGG + Exonic
1192233136 X:69279405-69279427 GCTAGAGCTGAGGCCCCAGCTGG - Intergenic
1194325874 X:92515501-92515523 GCTGTAGCCGCCGCCGCCGCGGG + Intronic
1200634596 Y:5634659-5634681 GCTGTAGCCGCCGCCGCCGCGGG + Intronic