ID: 1052196817

View in Genome Browser
Species Human (GRCh38)
Location 9:25727431-25727453
Sequence TGGAAGTGCGAATATAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052196817_1052196822 6 Left 1052196817 9:25727431-25727453 CCTCCTCTATATTCGCACTTCCA No data
Right 1052196822 9:25727460-25727482 CAGTGAGGTCCTTATTATTTTGG No data
1052196817_1052196819 -9 Left 1052196817 9:25727431-25727453 CCTCCTCTATATTCGCACTTCCA No data
Right 1052196819 9:25727445-25727467 GCACTTCCATTGCCTCAGTGAGG No data
1052196817_1052196824 25 Left 1052196817 9:25727431-25727453 CCTCCTCTATATTCGCACTTCCA No data
Right 1052196824 9:25727479-25727501 TTGGAAGTTGATATCTGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052196817 Original CRISPR TGGAAGTGCGAATATAGAGG AGG (reversed) Intergenic
No off target data available for this crispr