ID: 1052197894

View in Genome Browser
Species Human (GRCh38)
Location 9:25740373-25740395
Sequence GTGTGTGTATGGAGTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052197890_1052197894 17 Left 1052197890 9:25740333-25740355 CCTAGATCGTGTGTGTGTGTGTG No data
Right 1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG No data
1052197889_1052197894 22 Left 1052197889 9:25740328-25740350 CCACTCCTAGATCGTGTGTGTGT No data
Right 1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052197894 Original CRISPR GTGTGTGTATGGAGTGGAGA GGG Intergenic
No off target data available for this crispr