ID: 1052207708

View in Genome Browser
Species Human (GRCh38)
Location 9:25863423-25863445
Sequence GTTGTATAGTGAGGAAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052207706_1052207708 -2 Left 1052207706 9:25863402-25863424 CCAAAACATGGCATAATTGAAGT No data
Right 1052207708 9:25863423-25863445 GTTGTATAGTGAGGAAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052207708 Original CRISPR GTTGTATAGTGAGGAAAACT TGG Intergenic
No off target data available for this crispr