ID: 1052216225

View in Genome Browser
Species Human (GRCh38)
Location 9:25969346-25969368
Sequence GATTCTATTGCTTCACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052216225_1052216227 18 Left 1052216225 9:25969346-25969368 CCAGCATGTGAAGCAATAGAATC No data
Right 1052216227 9:25969387-25969409 CATCACATATCACCTTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052216225 Original CRISPR GATTCTATTGCTTCACATGC TGG (reversed) Intergenic
No off target data available for this crispr