ID: 1052218254

View in Genome Browser
Species Human (GRCh38)
Location 9:25991956-25991978
Sequence GGGTAATGAAGCAGTTTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052218254_1052218255 -7 Left 1052218254 9:25991956-25991978 CCACTTAAACTGCTTCATTACCC No data
Right 1052218255 9:25991972-25991994 ATTACCCTCTAAATACACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052218254 Original CRISPR GGGTAATGAAGCAGTTTAAG TGG (reversed) Intergenic
No off target data available for this crispr