ID: 1052220715

View in Genome Browser
Species Human (GRCh38)
Location 9:26018288-26018310
Sequence TAAAATGCTGATAATGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052220715_1052220718 4 Left 1052220715 9:26018288-26018310 CCCATATCATTATCAGCATTTTA No data
Right 1052220718 9:26018315-26018337 AAGGCATTCAACAAGTCTCTAGG 0: 26
1: 1599
2: 1943
3: 1387
4: 1044

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052220715 Original CRISPR TAAAATGCTGATAATGATAT GGG (reversed) Intergenic
No off target data available for this crispr