ID: 1052224416

View in Genome Browser
Species Human (GRCh38)
Location 9:26067883-26067905
Sequence CTCTATCTCCACTTGCTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052224416_1052224418 -6 Left 1052224416 9:26067883-26067905 CCCTGTAGCAAGTGGAGATAGAG No data
Right 1052224418 9:26067900-26067922 ATAGAGTCTGTTTCAGCAAGAGG No data
1052224416_1052224420 30 Left 1052224416 9:26067883-26067905 CCCTGTAGCAAGTGGAGATAGAG No data
Right 1052224420 9:26067936-26067958 GCAAAATAAACAACACTGTCAGG No data
1052224416_1052224419 -1 Left 1052224416 9:26067883-26067905 CCCTGTAGCAAGTGGAGATAGAG No data
Right 1052224419 9:26067905-26067927 GTCTGTTTCAGCAAGAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052224416 Original CRISPR CTCTATCTCCACTTGCTACA GGG (reversed) Intergenic
No off target data available for this crispr