ID: 1052231966

View in Genome Browser
Species Human (GRCh38)
Location 9:26164829-26164851
Sequence TACCCTGCCCCCTTCGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052231966_1052231968 12 Left 1052231966 9:26164829-26164851 CCAACTACGAAGGGGGCAGGGTA No data
Right 1052231968 9:26164864-26164886 ACCCTGACTCTCCACTAAGCTGG 0: 3
1: 36
2: 67
3: 66
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052231966 Original CRISPR TACCCTGCCCCCTTCGTAGT TGG (reversed) Intergenic
No off target data available for this crispr