ID: 1052237933

View in Genome Browser
Species Human (GRCh38)
Location 9:26235071-26235093
Sequence GGGGTGCCCCCTCATTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052237933_1052237940 20 Left 1052237933 9:26235071-26235093 CCTCAGGAATGAGGGGGCACCCC No data
Right 1052237940 9:26235114-26235136 CTATCTCCAACAGCCTCTTTGGG No data
1052237933_1052237939 19 Left 1052237933 9:26235071-26235093 CCTCAGGAATGAGGGGGCACCCC No data
Right 1052237939 9:26235113-26235135 CCTATCTCCAACAGCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052237933 Original CRISPR GGGGTGCCCCCTCATTCCTG AGG (reversed) Intergenic
No off target data available for this crispr