ID: 1052238653

View in Genome Browser
Species Human (GRCh38)
Location 9:26245718-26245740
Sequence CCACATATTCAGAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052238653_1052238662 -2 Left 1052238653 9:26245718-26245740 CCAGCCTCCCTCTGAATATGTGG No data
Right 1052238662 9:26245739-26245761 GGAGGGCAGTGGGCAGTCAGAGG No data
1052238653_1052238663 -1 Left 1052238653 9:26245718-26245740 CCAGCCTCCCTCTGAATATGTGG No data
Right 1052238663 9:26245740-26245762 GAGGGCAGTGGGCAGTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052238653 Original CRISPR CCACATATTCAGAGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr