ID: 1052249439

View in Genome Browser
Species Human (GRCh38)
Location 9:26380185-26380207
Sequence CTGGCTACAAACTGTTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052249439_1052249440 -9 Left 1052249439 9:26380185-26380207 CCTGCAAAACAGTTTGTAGCCAG No data
Right 1052249440 9:26380199-26380221 TGTAGCCAGAAGCTGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052249439 Original CRISPR CTGGCTACAAACTGTTTTGC AGG (reversed) Intergenic
No off target data available for this crispr