ID: 1052250822

View in Genome Browser
Species Human (GRCh38)
Location 9:26395150-26395172
Sequence ACCTCCTAGAAGATAATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052250822_1052250824 16 Left 1052250822 9:26395150-26395172 CCCTGCATTATCTTCTAGGAGGT No data
Right 1052250824 9:26395189-26395211 AGTATTACAGTTTTGTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052250822 Original CRISPR ACCTCCTAGAAGATAATGCA GGG (reversed) Intergenic
No off target data available for this crispr