ID: 1052261795

View in Genome Browser
Species Human (GRCh38)
Location 9:26525284-26525306
Sequence GGACAACTCTATCAGGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052261787_1052261795 3 Left 1052261787 9:26525258-26525280 CCGAGGTGAAGGAGGAGCCTTTT No data
Right 1052261795 9:26525284-26525306 GGACAACTCTATCAGGGGAAGGG No data
1052261786_1052261795 7 Left 1052261786 9:26525254-26525276 CCAGCCGAGGTGAAGGAGGAGCC No data
Right 1052261795 9:26525284-26525306 GGACAACTCTATCAGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052261795 Original CRISPR GGACAACTCTATCAGGGGAA GGG Intergenic
No off target data available for this crispr