ID: 1052262124

View in Genome Browser
Species Human (GRCh38)
Location 9:26529209-26529231
Sequence GTATATCCTTGGGCATAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052262124_1052262129 26 Left 1052262124 9:26529209-26529231 CCCCACTATGCCCAAGGATATAC No data
Right 1052262129 9:26529258-26529280 GCTTCTCAGACCAACCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052262124 Original CRISPR GTATATCCTTGGGCATAGTG GGG (reversed) Intergenic
No off target data available for this crispr