ID: 1052262129

View in Genome Browser
Species Human (GRCh38)
Location 9:26529258-26529280
Sequence GCTTCTCAGACCAACCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052262126_1052262129 24 Left 1052262126 9:26529211-26529233 CCACTATGCCCAAGGATATACAG No data
Right 1052262129 9:26529258-26529280 GCTTCTCAGACCAACCTGCATGG No data
1052262125_1052262129 25 Left 1052262125 9:26529210-26529232 CCCACTATGCCCAAGGATATACA No data
Right 1052262129 9:26529258-26529280 GCTTCTCAGACCAACCTGCATGG No data
1052262127_1052262129 16 Left 1052262127 9:26529219-26529241 CCCAAGGATATACAGATAGTGAA No data
Right 1052262129 9:26529258-26529280 GCTTCTCAGACCAACCTGCATGG No data
1052262124_1052262129 26 Left 1052262124 9:26529209-26529231 CCCCACTATGCCCAAGGATATAC No data
Right 1052262129 9:26529258-26529280 GCTTCTCAGACCAACCTGCATGG No data
1052262128_1052262129 15 Left 1052262128 9:26529220-26529242 CCAAGGATATACAGATAGTGAAC No data
Right 1052262129 9:26529258-26529280 GCTTCTCAGACCAACCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052262129 Original CRISPR GCTTCTCAGACCAACCTGCA TGG Intergenic
No off target data available for this crispr