ID: 1052263602

View in Genome Browser
Species Human (GRCh38)
Location 9:26546352-26546374
Sequence ATTACTAAAGGGCTGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052263597_1052263602 2 Left 1052263597 9:26546327-26546349 CCATTGCTATCAAATGGCTATGC No data
Right 1052263602 9:26546352-26546374 ATTACTAAAGGGCTGGTGGCTGG No data
1052263596_1052263602 3 Left 1052263596 9:26546326-26546348 CCCATTGCTATCAAATGGCTATG No data
Right 1052263602 9:26546352-26546374 ATTACTAAAGGGCTGGTGGCTGG No data
1052263594_1052263602 13 Left 1052263594 9:26546316-26546338 CCTTCAAGGGCCCATTGCTATCA No data
Right 1052263602 9:26546352-26546374 ATTACTAAAGGGCTGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052263602 Original CRISPR ATTACTAAAGGGCTGGTGGC TGG Intergenic
No off target data available for this crispr