ID: 1052267915

View in Genome Browser
Species Human (GRCh38)
Location 9:26595556-26595578
Sequence GAGGCTGTTAAAACCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052267915_1052267919 6 Left 1052267915 9:26595556-26595578 CCAGGCTGGGTTTTAACAGCCTC No data
Right 1052267919 9:26595585-26595607 CCTGAATCAAGTTGACTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052267915 Original CRISPR GAGGCTGTTAAAACCCAGCC TGG (reversed) Intergenic