ID: 1052268730

View in Genome Browser
Species Human (GRCh38)
Location 9:26604451-26604473
Sequence TTCTGAGGGGGAACCCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052268730_1052268736 -4 Left 1052268730 9:26604451-26604473 CCAGCTGGGGTTCCCCCTCAGAA No data
Right 1052268736 9:26604470-26604492 AGAAACAGACAGTGCAAGGCAGG No data
1052268730_1052268737 16 Left 1052268730 9:26604451-26604473 CCAGCTGGGGTTCCCCCTCAGAA No data
Right 1052268737 9:26604490-26604512 AGGCCCACTAATGAGTCTCATGG No data
1052268730_1052268738 17 Left 1052268730 9:26604451-26604473 CCAGCTGGGGTTCCCCCTCAGAA No data
Right 1052268738 9:26604491-26604513 GGCCCACTAATGAGTCTCATGGG No data
1052268730_1052268735 -8 Left 1052268730 9:26604451-26604473 CCAGCTGGGGTTCCCCCTCAGAA No data
Right 1052268735 9:26604466-26604488 CCTCAGAAACAGACAGTGCAAGG No data
1052268730_1052268739 18 Left 1052268730 9:26604451-26604473 CCAGCTGGGGTTCCCCCTCAGAA No data
Right 1052268739 9:26604492-26604514 GCCCACTAATGAGTCTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052268730 Original CRISPR TTCTGAGGGGGAACCCCAGC TGG (reversed) Intergenic
No off target data available for this crispr