ID: 1052268735

View in Genome Browser
Species Human (GRCh38)
Location 9:26604466-26604488
Sequence CCTCAGAAACAGACAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052268730_1052268735 -8 Left 1052268730 9:26604451-26604473 CCAGCTGGGGTTCCCCCTCAGAA No data
Right 1052268735 9:26604466-26604488 CCTCAGAAACAGACAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052268735 Original CRISPR CCTCAGAAACAGACAGTGCA AGG Intergenic
No off target data available for this crispr