ID: 1052273743

View in Genome Browser
Species Human (GRCh38)
Location 9:26655287-26655309
Sequence GCCCTTCAGGAGAACTGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052273739_1052273743 1 Left 1052273739 9:26655263-26655285 CCTGTGGAAGGCAGCTTTGGCCT No data
Right 1052273743 9:26655287-26655309 GCCCTTCAGGAGAACTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052273743 Original CRISPR GCCCTTCAGGAGAACTGTGT AGG Intergenic
No off target data available for this crispr