ID: 1052273897

View in Genome Browser
Species Human (GRCh38)
Location 9:26656736-26656758
Sequence CAGCTGGTGGAGGGGACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052273897_1052273905 20 Left 1052273897 9:26656736-26656758 CCTTTTGTCCCCTCCACCAGCTG No data
Right 1052273905 9:26656779-26656801 TCGCAGAAAGCCGATGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052273897 Original CRISPR CAGCTGGTGGAGGGGACAAA AGG (reversed) Intergenic
No off target data available for this crispr