ID: 1052274341

View in Genome Browser
Species Human (GRCh38)
Location 9:26660736-26660758
Sequence CTGGCGATTTACAGTGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052274341_1052274345 -4 Left 1052274341 9:26660736-26660758 CCCACAACACTGTAAATCGCCAG No data
Right 1052274345 9:26660755-26660777 CCAGGACTCAGAAAAATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052274341 Original CRISPR CTGGCGATTTACAGTGTTGT GGG (reversed) Intergenic
No off target data available for this crispr