ID: 1052274345

View in Genome Browser
Species Human (GRCh38)
Location 9:26660755-26660777
Sequence CCAGGACTCAGAAAAATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052274339_1052274345 -2 Left 1052274339 9:26660734-26660756 CCCCCACAACACTGTAAATCGCC No data
Right 1052274345 9:26660755-26660777 CCAGGACTCAGAAAAATATCTGG No data
1052274342_1052274345 -5 Left 1052274342 9:26660737-26660759 CCACAACACTGTAAATCGCCAGG No data
Right 1052274345 9:26660755-26660777 CCAGGACTCAGAAAAATATCTGG No data
1052274340_1052274345 -3 Left 1052274340 9:26660735-26660757 CCCCACAACACTGTAAATCGCCA No data
Right 1052274345 9:26660755-26660777 CCAGGACTCAGAAAAATATCTGG No data
1052274341_1052274345 -4 Left 1052274341 9:26660736-26660758 CCCACAACACTGTAAATCGCCAG No data
Right 1052274345 9:26660755-26660777 CCAGGACTCAGAAAAATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052274345 Original CRISPR CCAGGACTCAGAAAAATATC TGG Intergenic
No off target data available for this crispr