ID: 1052278499

View in Genome Browser
Species Human (GRCh38)
Location 9:26705787-26705809
Sequence CAGGTTGGTATCCTGGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052278494_1052278499 8 Left 1052278494 9:26705756-26705778 CCACCAAATGCATTTGTCAACAT No data
Right 1052278499 9:26705787-26705809 CAGGTTGGTATCCTGGAGATTGG No data
1052278495_1052278499 5 Left 1052278495 9:26705759-26705781 CCAAATGCATTTGTCAACATGCT No data
Right 1052278499 9:26705787-26705809 CAGGTTGGTATCCTGGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052278499 Original CRISPR CAGGTTGGTATCCTGGAGAT TGG Intergenic
No off target data available for this crispr