ID: 1052279691

View in Genome Browser
Species Human (GRCh38)
Location 9:26718887-26718909
Sequence AGGTAAATATGAATGTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052279691_1052279698 4 Left 1052279691 9:26718887-26718909 CCCCCCAACATTCATATTTACCT No data
Right 1052279698 9:26718914-26718936 CCTCAGAATGTGATCCTCTTTGG No data
1052279691_1052279699 11 Left 1052279691 9:26718887-26718909 CCCCCCAACATTCATATTTACCT No data
Right 1052279699 9:26718921-26718943 ATGTGATCCTCTTTGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052279691 Original CRISPR AGGTAAATATGAATGTTGGG GGG (reversed) Intergenic
No off target data available for this crispr