ID: 1052283220

View in Genome Browser
Species Human (GRCh38)
Location 9:26756131-26756153
Sequence TACCAGACAACAAAGCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052283220_1052283228 30 Left 1052283220 9:26756131-26756153 CCTAGCAGCTTTGTTGTCTGGTA No data
Right 1052283228 9:26756184-26756206 CAAGGAGGCCCTGCACCCACTGG No data
1052283220_1052283226 15 Left 1052283220 9:26756131-26756153 CCTAGCAGCTTTGTTGTCTGGTA No data
Right 1052283226 9:26756169-26756191 CTTCAAAGATGGTGCCAAGGAGG No data
1052283220_1052283225 12 Left 1052283220 9:26756131-26756153 CCTAGCAGCTTTGTTGTCTGGTA No data
Right 1052283225 9:26756166-26756188 CTGCTTCAAAGATGGTGCCAAGG No data
1052283220_1052283222 4 Left 1052283220 9:26756131-26756153 CCTAGCAGCTTTGTTGTCTGGTA No data
Right 1052283222 9:26756158-26756180 TCCGGCCTCTGCTTCAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052283220 Original CRISPR TACCAGACAACAAAGCTGCT AGG (reversed) Intergenic
No off target data available for this crispr