ID: 1052283224

View in Genome Browser
Species Human (GRCh38)
Location 9:26756163-26756185
Sequence TGGCACCATCTTTGAAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052283224_1052283236 29 Left 1052283224 9:26756163-26756185 CCTCTGCTTCAAAGATGGTGCCA No data
Right 1052283236 9:26756215-26756237 AATGCTGTGTACTCACATGGAGG No data
1052283224_1052283230 2 Left 1052283224 9:26756163-26756185 CCTCTGCTTCAAAGATGGTGCCA No data
Right 1052283230 9:26756188-26756210 GAGGCCCTGCACCCACTGGAGGG No data
1052283224_1052283229 1 Left 1052283224 9:26756163-26756185 CCTCTGCTTCAAAGATGGTGCCA No data
Right 1052283229 9:26756187-26756209 GGAGGCCCTGCACCCACTGGAGG No data
1052283224_1052283235 26 Left 1052283224 9:26756163-26756185 CCTCTGCTTCAAAGATGGTGCCA No data
Right 1052283235 9:26756212-26756234 ATGAATGCTGTGTACTCACATGG No data
1052283224_1052283228 -2 Left 1052283224 9:26756163-26756185 CCTCTGCTTCAAAGATGGTGCCA No data
Right 1052283228 9:26756184-26756206 CAAGGAGGCCCTGCACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052283224 Original CRISPR TGGCACCATCTTTGAAGCAG AGG (reversed) Intergenic
No off target data available for this crispr