ID: 1052283228

View in Genome Browser
Species Human (GRCh38)
Location 9:26756184-26756206
Sequence CAAGGAGGCCCTGCACCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052283224_1052283228 -2 Left 1052283224 9:26756163-26756185 CCTCTGCTTCAAAGATGGTGCCA No data
Right 1052283228 9:26756184-26756206 CAAGGAGGCCCTGCACCCACTGG No data
1052283223_1052283228 2 Left 1052283223 9:26756159-26756181 CCGGCCTCTGCTTCAAAGATGGT No data
Right 1052283228 9:26756184-26756206 CAAGGAGGCCCTGCACCCACTGG No data
1052283220_1052283228 30 Left 1052283220 9:26756131-26756153 CCTAGCAGCTTTGTTGTCTGGTA No data
Right 1052283228 9:26756184-26756206 CAAGGAGGCCCTGCACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052283228 Original CRISPR CAAGGAGGCCCTGCACCCAC TGG Intergenic
No off target data available for this crispr