ID: 1052283229

View in Genome Browser
Species Human (GRCh38)
Location 9:26756187-26756209
Sequence GGAGGCCCTGCACCCACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052283223_1052283229 5 Left 1052283223 9:26756159-26756181 CCGGCCTCTGCTTCAAAGATGGT No data
Right 1052283229 9:26756187-26756209 GGAGGCCCTGCACCCACTGGAGG No data
1052283224_1052283229 1 Left 1052283224 9:26756163-26756185 CCTCTGCTTCAAAGATGGTGCCA No data
Right 1052283229 9:26756187-26756209 GGAGGCCCTGCACCCACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052283229 Original CRISPR GGAGGCCCTGCACCCACTGG AGG Intergenic
No off target data available for this crispr