ID: 1052283231

View in Genome Browser
Species Human (GRCh38)
Location 9:26756192-26756214
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052283231_1052283237 4 Left 1052283231 9:26756192-26756214 CCCTGCACCCACTGGAGGGAATG No data
Right 1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG No data
1052283231_1052283239 11 Left 1052283231 9:26756192-26756214 CCCTGCACCCACTGGAGGGAATG No data
Right 1052283239 9:26756226-26756248 CTCACATGGAGGAAGGTGGAAGG No data
1052283231_1052283235 -3 Left 1052283231 9:26756192-26756214 CCCTGCACCCACTGGAGGGAATG No data
Right 1052283235 9:26756212-26756234 ATGAATGCTGTGTACTCACATGG No data
1052283231_1052283238 7 Left 1052283231 9:26756192-26756214 CCCTGCACCCACTGGAGGGAATG No data
Right 1052283238 9:26756222-26756244 TGTACTCACATGGAGGAAGGTGG No data
1052283231_1052283236 0 Left 1052283231 9:26756192-26756214 CCCTGCACCCACTGGAGGGAATG No data
Right 1052283236 9:26756215-26756237 AATGCTGTGTACTCACATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052283231 Original CRISPR CATTCCCTCCAGTGGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr