ID: 1052283234

View in Genome Browser
Species Human (GRCh38)
Location 9:26756200-26756222
Sequence ACAGCATTCATTCCCTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052283234_1052283237 -4 Left 1052283234 9:26756200-26756222 CCACTGGAGGGAATGAATGCTGT No data
Right 1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG No data
1052283234_1052283238 -1 Left 1052283234 9:26756200-26756222 CCACTGGAGGGAATGAATGCTGT No data
Right 1052283238 9:26756222-26756244 TGTACTCACATGGAGGAAGGTGG No data
1052283234_1052283236 -8 Left 1052283234 9:26756200-26756222 CCACTGGAGGGAATGAATGCTGT No data
Right 1052283236 9:26756215-26756237 AATGCTGTGTACTCACATGGAGG No data
1052283234_1052283239 3 Left 1052283234 9:26756200-26756222 CCACTGGAGGGAATGAATGCTGT No data
Right 1052283239 9:26756226-26756248 CTCACATGGAGGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052283234 Original CRISPR ACAGCATTCATTCCCTCCAG TGG (reversed) Intergenic
No off target data available for this crispr