ID: 1052283237

View in Genome Browser
Species Human (GRCh38)
Location 9:26756219-26756241
Sequence CTGTGTACTCACATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052283231_1052283237 4 Left 1052283231 9:26756192-26756214 CCCTGCACCCACTGGAGGGAATG No data
Right 1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG No data
1052283234_1052283237 -4 Left 1052283234 9:26756200-26756222 CCACTGGAGGGAATGAATGCTGT No data
Right 1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG No data
1052283233_1052283237 -3 Left 1052283233 9:26756199-26756221 CCCACTGGAGGGAATGAATGCTG No data
Right 1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG No data
1052283227_1052283237 13 Left 1052283227 9:26756183-26756205 CCAAGGAGGCCCTGCACCCACTG No data
Right 1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG No data
1052283232_1052283237 3 Left 1052283232 9:26756193-26756215 CCTGCACCCACTGGAGGGAATGA No data
Right 1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052283237 Original CRISPR CTGTGTACTCACATGGAGGA AGG Intergenic
No off target data available for this crispr