ID: 1052283238

View in Genome Browser
Species Human (GRCh38)
Location 9:26756222-26756244
Sequence TGTACTCACATGGAGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052283232_1052283238 6 Left 1052283232 9:26756193-26756215 CCTGCACCCACTGGAGGGAATGA No data
Right 1052283238 9:26756222-26756244 TGTACTCACATGGAGGAAGGTGG No data
1052283227_1052283238 16 Left 1052283227 9:26756183-26756205 CCAAGGAGGCCCTGCACCCACTG No data
Right 1052283238 9:26756222-26756244 TGTACTCACATGGAGGAAGGTGG No data
1052283233_1052283238 0 Left 1052283233 9:26756199-26756221 CCCACTGGAGGGAATGAATGCTG No data
Right 1052283238 9:26756222-26756244 TGTACTCACATGGAGGAAGGTGG No data
1052283231_1052283238 7 Left 1052283231 9:26756192-26756214 CCCTGCACCCACTGGAGGGAATG No data
Right 1052283238 9:26756222-26756244 TGTACTCACATGGAGGAAGGTGG No data
1052283234_1052283238 -1 Left 1052283234 9:26756200-26756222 CCACTGGAGGGAATGAATGCTGT No data
Right 1052283238 9:26756222-26756244 TGTACTCACATGGAGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052283238 Original CRISPR TGTACTCACATGGAGGAAGG TGG Intergenic
No off target data available for this crispr