ID: 1052283239

View in Genome Browser
Species Human (GRCh38)
Location 9:26756226-26756248
Sequence CTCACATGGAGGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052283233_1052283239 4 Left 1052283233 9:26756199-26756221 CCCACTGGAGGGAATGAATGCTG No data
Right 1052283239 9:26756226-26756248 CTCACATGGAGGAAGGTGGAAGG No data
1052283227_1052283239 20 Left 1052283227 9:26756183-26756205 CCAAGGAGGCCCTGCACCCACTG No data
Right 1052283239 9:26756226-26756248 CTCACATGGAGGAAGGTGGAAGG No data
1052283231_1052283239 11 Left 1052283231 9:26756192-26756214 CCCTGCACCCACTGGAGGGAATG No data
Right 1052283239 9:26756226-26756248 CTCACATGGAGGAAGGTGGAAGG No data
1052283234_1052283239 3 Left 1052283234 9:26756200-26756222 CCACTGGAGGGAATGAATGCTGT No data
Right 1052283239 9:26756226-26756248 CTCACATGGAGGAAGGTGGAAGG No data
1052283232_1052283239 10 Left 1052283232 9:26756193-26756215 CCTGCACCCACTGGAGGGAATGA No data
Right 1052283239 9:26756226-26756248 CTCACATGGAGGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052283239 Original CRISPR CTCACATGGAGGAAGGTGGA AGG Intergenic
No off target data available for this crispr