ID: 1052286562

View in Genome Browser
Species Human (GRCh38)
Location 9:26792622-26792644
Sequence TCTACCAAACTGAACAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052286562_1052286564 -1 Left 1052286562 9:26792622-26792644 CCCACATTGTTCAGTTTGGTAGA No data
Right 1052286564 9:26792644-26792666 AAATGACCTATAAAACCCTCAGG No data
1052286562_1052286568 25 Left 1052286562 9:26792622-26792644 CCCACATTGTTCAGTTTGGTAGA No data
Right 1052286568 9:26792670-26792692 TTTTGTTTGTTTCCGTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052286562 Original CRISPR TCTACCAAACTGAACAATGT GGG (reversed) Intergenic
No off target data available for this crispr