ID: 1052287643

View in Genome Browser
Species Human (GRCh38)
Location 9:26804835-26804857
Sequence CAGGCAAAAAATCTTGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052287643_1052287648 27 Left 1052287643 9:26804835-26804857 CCAACAGCAAGATTTTTTGCCTG No data
Right 1052287648 9:26804885-26804907 GTGTTTGGCACATAGTAAGTAGG No data
1052287643_1052287646 12 Left 1052287643 9:26804835-26804857 CCAACAGCAAGATTTTTTGCCTG No data
Right 1052287646 9:26804870-26804892 CAAGCACCTAGTACTGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052287643 Original CRISPR CAGGCAAAAAATCTTGCTGT TGG (reversed) Intergenic
No off target data available for this crispr