ID: 1052293678

View in Genome Browser
Species Human (GRCh38)
Location 9:26873214-26873236
Sequence CAGCTGCTCACTTGTCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 716
Summary {0: 1, 1: 0, 2: 1, 3: 85, 4: 629}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052293678 Original CRISPR CAGCTGCTCACTTGTCACCC TGG (reversed) Intronic
900303083 1:1987565-1987587 CAGAGCCTCGCTTGTCACCCAGG + Intronic
900336828 1:2168466-2168488 CAGCTCCTCACTTGGGGCCCAGG + Intronic
901809522 1:11759553-11759575 CAGTTTCACTCTTGTCACCCAGG + Intergenic
902430948 1:16362632-16362654 GAGATTCTCTCTTGTCACCCAGG - Intronic
902603946 1:17558466-17558488 CAGCTGGCCACTTGTCCCTCTGG - Intronic
903038186 1:20508226-20508248 CAGCAGCTTGATTGTCACCCGGG - Intergenic
903338424 1:22639727-22639749 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
903433378 1:23326757-23326779 CAGTTTCACTCTTGTCACCCAGG - Intronic
903594098 1:24480824-24480846 GAGCTCCGCTCTTGTCACCCAGG + Intergenic
903958072 1:27038815-27038837 CAGTTTCACTCTTGTCACCCAGG - Intergenic
903958693 1:27042558-27042580 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
904777118 1:32917164-32917186 GAGTTTCTCTCTTGTCACCCCGG + Intergenic
904991291 1:34594922-34594944 CAGCTGCTCCCTCCTCACTCAGG - Intergenic
905034608 1:34909450-34909472 CACCTGCTCACCTATCTCCCAGG + Intronic
905190250 1:36228241-36228263 GAGTTTCTCTCTTGTCACCCAGG + Intronic
905428104 1:37900278-37900300 CAGAGTCTCTCTTGTCACCCAGG + Intronic
905768214 1:40620805-40620827 CAGCTGTGCACCTGCCACCCGGG + Exonic
906312537 1:44764199-44764221 CAGAGTCTCACTCGTCACCCAGG + Intronic
907025572 1:51114695-51114717 CAGAGTCTCGCTTGTCACCCAGG - Intronic
907572623 1:55497976-55497998 CAGCCCTTCACTGGTCACCCTGG + Intergenic
907844040 1:58187603-58187625 GAGTTGCACTCTTGTCACCCAGG + Intronic
907922618 1:58927845-58927867 CAGCTGCTCAATGATCACCTGGG + Intergenic
908174335 1:61539520-61539542 CAGTTTCGCTCTTGTCACCCAGG + Intergenic
908236020 1:62147935-62147957 CAGTTTCACTCTTGTCACCCAGG - Intronic
908698360 1:66870414-66870436 CAGTTTCGCTCTTGTCACCCAGG - Intronic
909760260 1:79277529-79277551 CAGAGTCTCACTTATCACCCAGG + Intergenic
909955827 1:81777735-81777757 CAGAGTCTCACTTGTCACCCAGG - Intronic
910289581 1:85587509-85587531 TAGCTTCTTACTTGGCACCCAGG + Intergenic
910896518 1:92075741-92075763 CAGTTTCACTCTTGTCACCCAGG + Intergenic
911653223 1:100413029-100413051 CAGTTTCGCTCTTGTCACCCAGG - Intronic
911660450 1:100495963-100495985 CAGATGCTCACATATCACCAGGG - Intronic
912773177 1:112484325-112484347 GAGGGTCTCACTTGTCACCCAGG + Intronic
914462071 1:147894168-147894190 CAGAGTCTCACTTGTCACCCAGG - Intergenic
914721156 1:150290131-150290153 CAGAGTCTCACATGTCACCCAGG + Intergenic
915031379 1:152883016-152883038 GAGCTTCGCTCTTGTCACCCAGG - Intronic
915234953 1:154473776-154473798 CAGGGTCTCACTCGTCACCCAGG - Intronic
915375959 1:155395805-155395827 CAGGGTCTCACTTGTTACCCAGG - Intronic
915582746 1:156824914-156824936 GAGTTTCTCTCTTGTCACCCAGG + Intronic
916200252 1:162264530-162264552 CAGAGTCTCACTGGTCACCCAGG + Intronic
916236197 1:162591509-162591531 CAGTTTCACTCTTGTCACCCAGG + Intronic
916266191 1:162892022-162892044 GAGCTTCACTCTTGTCACCCAGG + Intergenic
916753084 1:167741353-167741375 CAAGGTCTCACTTGTCACCCAGG + Intronic
916824250 1:168429034-168429056 CAGCTGGTCAGTTTTCACCTGGG - Intergenic
917177092 1:172247708-172247730 CAGTTTCGCTCTTGTCACCCAGG + Intronic
917603254 1:176598811-176598833 CTGCTGCACAGTTGTCATCCTGG + Intronic
918497880 1:185159749-185159771 GAGTTTCGCACTTGTCACCCAGG + Intronic
918779156 1:188673575-188673597 CAGTTTCACTCTTGTCACCCAGG - Intergenic
918939812 1:190978597-190978619 CACCTTCTCTCTTGTCACTCAGG + Intergenic
919679174 1:200417468-200417490 CAGAGTCTCACTTGTCACCCAGG + Intergenic
921229925 1:213059537-213059559 CAGAGTCTCACTTGTCATCCAGG + Intronic
922069663 1:222179036-222179058 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
922527861 1:226319917-226319939 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
923835783 1:237609393-237609415 CAGAGTCTCACTTGTCACCCAGG + Intronic
924471385 1:244345694-244345716 CAGGGTCTCACTTGTCACTCAGG - Intergenic
924714830 1:246563576-246563598 GAGTTTCTCTCTTGTCACCCAGG - Intronic
1064044108 10:11995755-11995777 CAGAGTCTCACTTGTCGCCCAGG - Intronic
1064229436 10:13517088-13517110 CAGGATCTCACTTGTCGCCCAGG + Intronic
1064337999 10:14460965-14460987 CTGCTGGTCTCTGGTCACCCAGG - Intronic
1064736386 10:18385615-18385637 GAGTTGCACTCTTGTCACCCAGG - Intronic
1065241589 10:23710367-23710389 CAGTTGCTCTGTTGTCACCAAGG + Intronic
1065956186 10:30695935-30695957 CAGCTTCTCAGAAGTCACCCTGG + Intergenic
1066007965 10:31165541-31165563 CAGCTGCACACTTGCAACCATGG - Intergenic
1066297379 10:34066676-34066698 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
1066750336 10:38649343-38649365 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1067556045 10:47272943-47272965 CAGTTTCGCTCTTGTCACCCAGG + Intergenic
1068978891 10:63039837-63039859 CAGAGTCTCACGTGTCACCCAGG - Intergenic
1069369394 10:67730586-67730608 CTACTGCTCACCTGTCATCCTGG - Intergenic
1069672950 10:70225241-70225263 CAGAGTCTCACCTGTCACCCAGG + Intronic
1070104708 10:73420643-73420665 CAGATTCTCACTTTTCACCCAGG + Intergenic
1070114035 10:73511766-73511788 CAGTTTCACTCTTGTCACCCAGG + Intronic
1070121646 10:73583309-73583331 AAGTTTCTCACTTGTCACCCAGG + Intronic
1070218478 10:74413030-74413052 CAGTTTCACTCTTGTCACCCAGG - Intronic
1070772363 10:79089806-79089828 CACCTGCTCCCTTTTTACCCAGG + Intronic
1071220598 10:83460371-83460393 CAGAGTCTCACCTGTCACCCAGG - Intergenic
1071312493 10:84356075-84356097 CAGTTTCACTCTTGTCACCCAGG - Intronic
1071862265 10:89686382-89686404 CAGAGTCTTACTTGTCACCCAGG + Intergenic
1072233240 10:93431052-93431074 GAGTTTCTCTCTTGTCACCCAGG + Intronic
1072453582 10:95558261-95558283 CAGGGTCTCACCTGTCACCCAGG - Intronic
1072526998 10:96281007-96281029 CAAGTTCTCACTTGTCACTCTGG + Intergenic
1073174294 10:101542900-101542922 GAGTTTCTCTCTTGTCACCCAGG + Intronic
1073244853 10:102082604-102082626 CAGGATCTCACTTGTCGCCCAGG + Intergenic
1073401780 10:103263454-103263476 CAGCATGTGACTTGTCACCCTGG + Intergenic
1073438440 10:103536516-103536538 CAGTTTCGCTCTTGTCACCCAGG - Intronic
1073466134 10:103695481-103695503 CAGAGTCTCACTTGTCACTCAGG - Intronic
1074066401 10:110018500-110018522 CAAAGTCTCACTTGTCACCCAGG - Intronic
1074569482 10:114611443-114611465 CAGAGTCTCACCTGTCACCCAGG - Intronic
1074633829 10:115290628-115290650 CAGTTTCACTCTTGTCACCCAGG - Intronic
1074658404 10:115621328-115621350 CAGCATCTTACTTGTCACCCAGG + Intronic
1075187372 10:120275251-120275273 AAGTTTCACACTTGTCACCCAGG + Intergenic
1075559724 10:123459928-123459950 CAGATGCTGCCTTGTCACCGTGG + Intergenic
1078300443 11:10125080-10125102 CAGTCTCTCTCTTGTCACCCAGG - Intronic
1078344456 11:10533176-10533198 CATCTGCCCAATTGTCACCAAGG + Intronic
1078412843 11:11141832-11141854 CAGCTGCTGGCCTGGCACCCAGG + Intergenic
1079226896 11:18614721-18614743 AAGCTGCTCACTGGTCTTCCTGG + Exonic
1080776239 11:35389494-35389516 GAGCTTCACTCTTGTCACCCTGG + Intronic
1081394869 11:42574635-42574657 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1081484663 11:43518384-43518406 CAGGGTCTCACTTGTCATCCAGG - Intergenic
1082268069 11:50141365-50141387 CAGAGTCTCACTTGTCGCCCAGG + Intergenic
1083946582 11:65926833-65926855 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
1084042910 11:66552829-66552851 CAGAGTCTCTCTTGTCACCCAGG - Intronic
1084081093 11:66825463-66825485 GAGTTTCGCACTTGTCACCCAGG - Intronic
1084374916 11:68769971-68769993 CGGCTGCTCACTCGGCTCCCAGG - Intronic
1085001598 11:73041950-73041972 CAGAGTCTCACTCGTCACCCAGG + Intronic
1085515517 11:77109682-77109704 CAGCTGCTCTGCTGTCAGCCAGG - Intronic
1086452203 11:86927913-86927935 GAGTTTCTCTCTTGTCACCCAGG - Intronic
1088249652 11:107851435-107851457 GAGTTTCTCTCTTGTCACCCAGG - Intronic
1088279214 11:108120164-108120186 CAGTCTCGCACTTGTCACCCAGG - Intergenic
1088375162 11:109132833-109132855 CAGCTGCTTACTTGTGAAACAGG + Intergenic
1088767179 11:112993996-112994018 CAGCTGCACAGCTGTCACCCTGG + Intronic
1088895330 11:114074179-114074201 CAGCGGCTCCCTTGTCAGGCTGG - Intronic
1089185554 11:116612332-116612354 CATCTGCTCTCTTTTCAGCCAGG - Intergenic
1090712596 11:129400918-129400940 CAGCTGATCACTTGTTCCTCTGG - Intronic
1090732298 11:129582387-129582409 CAAAGTCTCACTTGTCACCCAGG + Intergenic
1090765859 11:129875680-129875702 CAGTTTCGCTCTTGTCACCCAGG + Intronic
1091250011 11:134136042-134136064 CAGTTTCACTCTTGTCACCCAGG - Intronic
1091574987 12:1725145-1725167 CAGTTTCACTCTTGTCACCCAGG + Intronic
1091730261 12:2875784-2875806 GAGCTTCGCTCTTGTCACCCAGG + Intronic
1092251223 12:6898544-6898566 GAGTTTCTCTCTTGTCACCCAGG - Intronic
1092349238 12:7742152-7742174 GAGTTGCACTCTTGTCACCCAGG - Intronic
1092692108 12:11124866-11124888 GAGCTTCACTCTTGTCACCCAGG + Intronic
1093083302 12:14838617-14838639 CATCTCCTCACATGTCACCTTGG - Intronic
1093329064 12:17813078-17813100 CAGCAGCACACTTGCCACCATGG + Intergenic
1094541553 12:31367032-31367054 CAGAGTCTCACTTGTCGCCCAGG - Intergenic
1094791965 12:33926048-33926070 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
1095051899 12:37561996-37562018 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1095417803 12:41995162-41995184 GAGCTTCACTCTTGTCACCCAGG - Intergenic
1095466368 12:42491525-42491547 GAGTTTCTCTCTTGTCACCCAGG - Intronic
1095653526 12:44642148-44642170 CACCTGCTCACATGTATCCCTGG - Intronic
1096280911 12:50252553-50252575 CAGTTTCGCTCTTGTCACCCAGG - Intronic
1096295935 12:50384090-50384112 CAGAGTCTCACTTGTCGCCCAGG - Intronic
1096342444 12:50812797-50812819 CAGGGTCTCACTTGTCACCCAGG - Intronic
1096391060 12:51229436-51229458 CAGGGTCTCACTTGTCACCCAGG + Intergenic
1096640198 12:52988208-52988230 CAGTTTCGCTCTTGTCACCCAGG - Intergenic
1098258338 12:68641035-68641057 CAGGGTCTCACTTGTCACCCAGG + Intronic
1098325469 12:69297684-69297706 CAAGTGCTCACTTATCACCAGGG - Intergenic
1098371601 12:69766544-69766566 CAGTTTCACTCTTGTCACCCAGG + Intronic
1098563175 12:71901054-71901076 CAGATTCTTGCTTGTCACCCAGG + Intronic
1098858442 12:75680620-75680642 GAGCTTCGCTCTTGTCACCCAGG - Intergenic
1099133073 12:78861223-78861245 CAGTCTCGCACTTGTCACCCTGG + Intergenic
1099560511 12:84167787-84167809 CAGCTGATGAATTGTCATCCGGG + Intergenic
1099860843 12:88223382-88223404 CAAGAGCTCACTTGTCACCAAGG - Intergenic
1100234902 12:92651244-92651266 CAGTTTCACTCTTGTCACCCAGG + Intergenic
1100509568 12:95256075-95256097 CAGTTTCGCTCTTGTCACCCAGG + Intronic
1100643637 12:96506610-96506632 GAGTTTCTCTCTTGTCACCCAGG + Intronic
1100883316 12:99041973-99041995 CAGGGTCTCACTTGTCACCCAGG - Intronic
1101059772 12:100958820-100958842 CAGGTTCTCACTTGTTGCCCAGG - Intronic
1101650802 12:106675403-106675425 CAGAGTCTCACTCGTCACCCAGG - Intronic
1102115291 12:110398218-110398240 CAGAGTTTCACTTGTCACCCAGG - Intronic
1102147295 12:110663942-110663964 GAGGATCTCACTTGTCACCCAGG + Intronic
1102330519 12:112025208-112025230 CAGTTTCTCTCTTGTCCCCCAGG - Intergenic
1102425988 12:112844860-112844882 CAGCTGCAGACATGTCACCTGGG + Intronic
1102540810 12:113617874-113617896 GAGCTCCTCCCTTTTCACCCTGG + Intergenic
1103105968 12:118225220-118225242 CAGTCTCGCACTTGTCACCCAGG - Intronic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1104498054 12:129259302-129259324 CAACAGCTCAGATGTCACCCAGG - Intronic
1104761747 12:131300942-131300964 CTGCTGCTGACTTGTTCCCCAGG + Intergenic
1104818025 12:131659842-131659864 CTGCTGCTGACTTGTTCCCCAGG - Intergenic
1105563717 13:21521800-21521822 CAGGGTCTCACCTGTCACCCAGG + Intronic
1107528694 13:41260326-41260348 CAGGTTCTCACTTGTTGCCCAGG - Intronic
1108575066 13:51783330-51783352 CAGCAGCTCACTTGTTACTGAGG + Intronic
1109282292 13:60370968-60370990 CACTTTCTCTCTTGTCACCCAGG + Intergenic
1110352965 13:74531543-74531565 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
1110635658 13:77765258-77765280 CAAGAGCTCACTTATCACCCAGG + Intergenic
1111974250 13:94949054-94949076 TAGCTGGTCACTTAACACCCTGG - Intergenic
1112346930 13:98597752-98597774 CAGAGTCTCACCTGTCACCCAGG + Intergenic
1112370752 13:98791424-98791446 CAGAGTCTCACTTGTCACCTAGG + Intergenic
1113348864 13:109508498-109508520 CAGTTTCACTCTTGTCACCCAGG + Intergenic
1113359796 13:109619988-109620010 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
1113359841 13:109620297-109620319 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
1114398474 14:22388044-22388066 CTGCTGCTCTCTGGTCCCCCTGG + Intergenic
1115849357 14:37577195-37577217 CAGGGTCTCTCTTGTCACCCAGG + Intergenic
1116252713 14:42507427-42507449 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1116395854 14:44447972-44447994 GAGTTGCACTCTTGTCACCCAGG - Intergenic
1116446494 14:45017853-45017875 CAGAGTTTCACTTGTCACCCAGG - Intronic
1116698411 14:48204462-48204484 CAGAGTCTCGCTTGTCACCCAGG - Intergenic
1117543813 14:56773964-56773986 CAGGATCTCACTTGTCACCCAGG - Intergenic
1118228401 14:63925294-63925316 CAGGGTCTCACTCGTCACCCAGG - Intronic
1118267470 14:64308801-64308823 CAGAGTCTCACCTGTCACCCAGG + Intronic
1118471579 14:66079619-66079641 CATGTTCTCATTTGTCACCCAGG - Intergenic
1118567383 14:67156944-67156966 CAGAGTCTCACTTGTCACCCAGG - Intronic
1119041878 14:71281882-71281904 CAGGGTCTCATTTGTCACCCAGG - Intergenic
1119642735 14:76327205-76327227 CAGCTGCCTGCGTGTCACCCAGG + Intronic
1119734871 14:76975366-76975388 CATCTGCTCACTGTTCTCCCTGG + Intergenic
1120568631 14:86090770-86090792 AAGTTTCTCTCTTGTCACCCAGG + Intergenic
1121049636 14:90812036-90812058 CAGCTGACCCCTTGTGACCCTGG - Intronic
1121673991 14:95737428-95737450 CAGAGTCTCACTTGTCGCCCAGG - Intergenic
1121732680 14:96197519-96197541 CCTCTGATCACTTGTCACCAGGG - Intergenic
1122203708 14:100137816-100137838 CTCCTGCTCACATGTCCCCCAGG + Intronic
1122474402 14:101996645-101996667 CAGCATCTCACCTGTCACCCAGG + Intronic
1123049278 14:105532794-105532816 GAGCTGCCCACTTCTCCCCCGGG - Intergenic
1202892566 14_KI270722v1_random:172732-172754 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
1123575145 15:21658406-21658428 CAGTTTCACTCTTGTCACCCAGG + Intergenic
1123611762 15:22100895-22100917 CAGTTTCACTCTTGTCACCCAGG + Intergenic
1123671045 15:22657625-22657647 CAGCTGCTCAGTTGTTTCTCAGG - Intergenic
1123912052 15:24977610-24977632 CAGTTTCACTCTTGTCACCCAGG - Intronic
1124220207 15:27844533-27844555 CAGAGTCTCACTTGTCACCCAGG + Intronic
1124323089 15:28730859-28730881 CAGCTGCTCAGTTGTTTCTCAGG - Intronic
1124526983 15:30463962-30463984 CAGCTGCTCAGTTGTTTCTCAGG - Intergenic
1124771670 15:32543721-32543743 CAGCTGCTCAGTTGTTTCTCAGG + Intergenic
1124865084 15:33482443-33482465 GAGCTTCACTCTTGTCACCCAGG + Intronic
1125626113 15:41110462-41110484 CAGGGTCTCGCTTGTCACCCAGG + Intronic
1125712072 15:41795137-41795159 CAGGGTTTCACTTGTCACCCAGG - Intronic
1126131592 15:45347292-45347314 CAGATGCTCACTTTTCACTTAGG - Intergenic
1126387356 15:48107777-48107799 CAACTGCCCACTTGACACACAGG + Intergenic
1126481359 15:49124344-49124366 CAGTTTCGCTCTTGTCACCCAGG - Intronic
1126954768 15:53920525-53920547 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1127804665 15:62508240-62508262 GAGTTTCTCTCTTGTCACCCAGG + Intronic
1127955860 15:63852405-63852427 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
1127997266 15:64160670-64160692 GAGTTTCTCTCTTGTCACCCAGG + Intronic
1128340139 15:66816831-66816853 AAGTTGCTCAGTTGTCACCTTGG - Intergenic
1128651446 15:69416921-69416943 GAGTTTCTCTCTTGTCACCCAGG - Intronic
1128803029 15:70509134-70509156 TAGCTGCTCATTTGTCACAGTGG - Intergenic
1129855324 15:78820085-78820107 CAGAGTCTCACTTGTCACCCAGG - Intronic
1130523513 15:84683580-84683602 GAGTTTCGCACTTGTCACCCAGG + Intronic
1130560916 15:84958298-84958320 CTGCTGCTCAGCTGTCACCCTGG + Intergenic
1131034022 15:89209417-89209439 CAGGGTCTCACTTGTCACCCAGG - Intergenic
1202984013 15_KI270727v1_random:392650-392672 CAGTTTCACTCTTGTCACCCAGG + Intergenic
1132547399 16:539666-539688 CAGCTGCCCACATGCCACTCTGG - Intronic
1133947496 16:10361449-10361471 CAGTTTCACTCTTGTCACCCAGG + Intronic
1134148343 16:11785643-11785665 CAGAGTCTCACTTGTCACGCAGG + Intronic
1134244573 16:12530579-12530601 CAGTTGCGCTCTTGTCGCCCAGG + Intronic
1134454897 16:14387831-14387853 GAGCTTCGCTCTTGTCACCCAGG - Intergenic
1134536540 16:15030975-15030997 CAGGGTCTCATTTGTCACCCTGG + Intronic
1134566983 16:15260056-15260078 GAGTTTCGCACTTGTCACCCAGG - Intergenic
1134589518 16:15441242-15441264 CAGGGTCTCGCTTGTCACCCAGG + Intronic
1134611772 16:15614808-15614830 GAGCTTCACTCTTGTCACCCAGG + Intronic
1134735510 16:16496644-16496666 GAGTTTCGCACTTGTCACCCAGG + Intergenic
1134932017 16:18215574-18215596 GAGTTTCACACTTGTCACCCAGG - Intergenic
1136360700 16:29777806-29777828 CAGCTTGCCACCTGTCACCCAGG + Intergenic
1136407904 16:30059555-30059577 CAGGGTCTCTCTTGTCACCCAGG + Intronic
1136522142 16:30803991-30804013 CAGTTTCGCTCTTGTCACCCAGG + Intergenic
1136577517 16:31133225-31133247 CAGCTGCTCACTGCTTCCCCAGG - Exonic
1136732375 16:32427725-32427747 CAGTTTCACTCTTGTCACCCAGG + Intergenic
1137943919 16:52715947-52715969 GAGTTTCACACTTGTCACCCAGG - Intergenic
1138059083 16:53870180-53870202 CAGGGTCTCACTTGTCATCCAGG - Intronic
1138592939 16:58012434-58012456 CATCTGATATCTTGTCACCCCGG - Intronic
1139052663 16:63145291-63145313 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
1139714949 16:68805618-68805640 CAGTTTCACTCTTGTCACCCAGG + Intronic
1140177499 16:72677543-72677565 CAGGGTCTCATTTGTCACCCAGG - Intergenic
1140279703 16:73543537-73543559 CAGCTGCTCCCTTTACACCACGG - Intergenic
1140305352 16:73797838-73797860 CAATTGCACTCTTGTCACCCAGG + Intergenic
1140613747 16:76634178-76634200 CGGAGTCTCACTTGTCACCCAGG - Intronic
1141003902 16:80334342-80334364 CAGCTTCGCTCTTGTCACCCAGG - Intergenic
1141090859 16:81129424-81129446 CAGTTTCACTCTTGTCACCCAGG + Intergenic
1141172464 16:81700135-81700157 CAGCTACGCACTTCTCACCTGGG + Intronic
1141230417 16:82162212-82162234 CAGTTGTTTACTTGTCACCTTGG - Intronic
1141417783 16:83889956-83889978 CAGAGGCTCACTTGTTACCGTGG - Intergenic
1141824354 16:86468561-86468583 CATCTGCTCCCTTGTGATCCTGG - Intergenic
1141993025 16:87621203-87621225 CAGCAGCTAACTTCTCGCCCTGG + Intronic
1142216479 16:88832391-88832413 CAGCTGCGCACGTGGCACCCAGG - Intronic
1203020706 16_KI270728v1_random:401861-401883 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1203039041 16_KI270728v1_random:675019-675041 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1142583518 17:956437-956459 GAGATTCTCTCTTGTCACCCAGG + Intronic
1143256394 17:5561080-5561102 GAGTTTCTCTCTTGTCACCCAGG + Intronic
1144097976 17:11918958-11918980 GAGTTTCTCGCTTGTCACCCAGG - Intronic
1144112383 17:12048680-12048702 CAGTTTCACTCTTGTCACCCAGG + Intronic
1145058721 17:19719219-19719241 CAGCTGATCACTTGTTTCCAAGG + Intergenic
1145211914 17:21020153-21020175 CAGATGCTCACCTGTCAACTGGG + Intronic
1145325222 17:21817053-21817075 CAGGTTCTCGCCTGTCACCCAGG + Intergenic
1145393579 17:22476253-22476275 CAGTTTCGCTCTTGTCACCCAGG - Intergenic
1145746982 17:27327390-27327412 CAGAGTCTCACTCGTCACCCAGG - Intergenic
1145775962 17:27528877-27528899 CAGGGTCTCTCTTGTCACCCAGG - Intronic
1145872409 17:28285694-28285716 GAGCTTCGCTCTTGTCACCCAGG - Intergenic
1146201246 17:30860763-30860785 CAGTTTCTCTCTTGTCACCCAGG + Intronic
1146391209 17:32424868-32424890 CAGAGTCTCACTCGTCACCCAGG - Intergenic
1147634618 17:41956071-41956093 CTGAGTCTCACTTGTCACCCAGG + Intronic
1147902657 17:43799413-43799435 CAGAGTCTCATTTGTCACCCAGG + Intergenic
1148093330 17:45035665-45035687 CAGATGCCCACTGGTCCCCCTGG + Intronic
1148382856 17:47212188-47212210 GAGTTTCGCACTTGTCACCCAGG - Intronic
1148450373 17:47773816-47773838 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
1148501100 17:48092014-48092036 CAGTTTCACTCTTGTCACCCAGG + Intronic
1148654307 17:49271803-49271825 TAGCTTCTCTCTTGTTACCCAGG - Intergenic
1149786913 17:59443550-59443572 CAGGGTCTCACTTGTCACCCAGG + Intergenic
1149996478 17:61408516-61408538 CAGCTGCTCCCCTGCCACGCAGG + Exonic
1150048610 17:61937203-61937225 CAGGGTCTCACTCGTCACCCAGG + Intergenic
1150104298 17:62450794-62450816 CAGTTTCGCTCTTGTCACCCAGG - Intronic
1150385102 17:64752962-64752984 CAGTTTCACTCTTGTCACCCAGG + Intergenic
1150592446 17:66575552-66575574 CAGTTTCGCTCTTGTCACCCAGG - Intronic
1150729897 17:67683134-67683156 CAGTTTCGCTCTTGTCACCCGGG - Intronic
1151333142 17:73422993-73423015 GAGTTTCACACTTGTCACCCAGG - Intronic
1152222716 17:79077853-79077875 CAGGTCCTCACCTGTCATCCAGG - Exonic
1152336846 17:79703561-79703583 CTGCTGCTCACTTCTGCCCCAGG - Intergenic
1152584734 17:81183831-81183853 CAGCTGCTCACTGGCCACACAGG + Intergenic
1152900591 17:82938825-82938847 CACCTGCTCTCTTTTCACCAGGG - Intronic
1153137691 18:1935266-1935288 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
1153302117 18:3600275-3600297 GAGTTTCTCTCTTGTCACCCAGG + Intronic
1153829854 18:8912573-8912595 CAGCTGCTCTCCTGTCGCTCTGG + Intergenic
1153884318 18:9449711-9449733 CAGATTCTCACTTGTAGCCCAGG + Intergenic
1153911785 18:9711051-9711073 CTGCTGCACACATCTCACCCAGG - Intronic
1154083799 18:11282440-11282462 GAGCTTCACTCTTGTCACCCAGG + Intergenic
1154205479 18:12333381-12333403 CAGGGTCTCACTTGTCACCCAGG + Intronic
1155041256 18:22067163-22067185 CAGAGTCTCACTTATCACCCAGG - Intergenic
1155305715 18:24475980-24476002 CAGTTTCACGCTTGTCACCCAGG - Intronic
1155940098 18:31794329-31794351 CAGCTTTTCACTTGTTTCCCAGG + Intergenic
1156867963 18:41909628-41909650 CAGCTGGTCACTTGACTTCCAGG - Intergenic
1157236975 18:45974018-45974040 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1157253943 18:46121213-46121235 GAGTTTCTCTCTTGTCACCCAGG + Intronic
1157603630 18:48911651-48911673 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1157616266 18:48989500-48989522 CAGGGGCTCACCTGTCACCCAGG - Intergenic
1157815031 18:50724035-50724057 CAGGGTCTCACTTGTCACCCAGG + Intronic
1158549408 18:58422471-58422493 CAGGATCTCACTTGTCACCCAGG + Intergenic
1159058598 18:63491374-63491396 CAGTTTCTCTCTTCTCACCCAGG - Intronic
1160238996 18:77109135-77109157 CAGCTGCTCACCACCCACCCAGG - Intronic
1160735528 19:660653-660675 CAGCGTCTTGCTTGTCACCCAGG + Intronic
1160992719 19:1866586-1866608 CAGTTTCTCTCTTGTCACCCAGG - Intergenic
1161217855 19:3103555-3103577 CAAGGTCTCACTTGTCACCCAGG + Intronic
1161359411 19:3838868-3838890 CAGCTGCCCAGCTGTCTCCCGGG + Intronic
1161469829 19:4451376-4451398 AAGGGTCTCACTTGTCACCCAGG + Intronic
1161553050 19:4924850-4924872 CAGTGTCTCACTTGTCGCCCAGG + Intronic
1161558380 19:4957173-4957195 CAGCTGCTGACTTCCCACCCAGG - Intronic
1161994393 19:7703616-7703638 CAGCTGCTCCCTCTTCCCCCTGG + Intergenic
1162208089 19:9070898-9070920 CAGTTTCGCTCTTGTCACCCAGG + Intergenic
1162277892 19:9672803-9672825 CAGTTTCGCTCTTGTCACCCAGG + Intronic
1162345570 19:10116218-10116240 CAGCTTCTCAGGTGTCACCTTGG - Intronic
1162348235 19:10133899-10133921 CAGCTGCTCACTTGAGCCTCTGG - Intronic
1162360263 19:10215574-10215596 GAGTTTCTCTCTTGTCACCCAGG - Intronic
1162412772 19:10516579-10516601 GAGTTTCTCTCTTGTCACCCAGG - Intronic
1162777540 19:12989034-12989056 CGGAGTCTCACTTGTCACCCGGG - Intergenic
1163078432 19:14917769-14917791 CAGTTTCGCTCTTGTCACCCAGG + Intergenic
1163089842 19:15011926-15011948 CAGGTTCTCACCTGTCACCCAGG - Intronic
1163251915 19:16131144-16131166 CAGGATCTCACTTGTTACCCAGG + Intronic
1163771035 19:19191597-19191619 CAGGGTCTCACTTGTCACCCAGG + Intronic
1164135992 19:22416724-22416746 GAGCTTCTCTCTTGTCTCCCAGG - Intronic
1164182917 19:22835089-22835111 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
1164466255 19:28489832-28489854 CAGCTGCTCTCTTCTCCGCCAGG + Intergenic
1164479586 19:28601189-28601211 CAGGGTCTCACTTGTCACCCAGG + Intergenic
1164832453 19:31333078-31333100 CAGGATCTCCCTTGTCACCCAGG - Intronic
1165414620 19:35684863-35684885 GAGCTTCGCTCTTGTCACCCAGG + Intergenic
1165499374 19:36175768-36175790 CAGTTTCGCTCTTGTCACCCAGG + Intergenic
1165805705 19:38579562-38579584 GAGTTTCACACTTGTCACCCAGG - Intronic
1165876014 19:39007399-39007421 CACCTGCTCACCTGCCACCTGGG - Intronic
1166101547 19:40574385-40574407 GAGTTTCTCTCTTGTCACCCAGG + Intronic
1166322376 19:42026592-42026614 CGGAGTCTCACTTGTCACCCAGG + Intronic
1167232589 19:48294721-48294743 CAGCTTCACTCTTGTCTCCCAGG + Intergenic
1167334355 19:48875375-48875397 CAGCTGCTCCCTCCTCCCCCAGG - Intronic
1167409149 19:49334854-49334876 CAGGGTCTCACTTTTCACCCAGG - Intergenic
925271803 2:2615148-2615170 GAGCTTCACTCTTGTCACCCAGG + Intergenic
925649993 2:6079623-6079645 CAGCTTTTCACTTGTCACCTGGG + Intergenic
925819539 2:7786383-7786405 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
925827363 2:7862579-7862601 CAGTTGCTCAGGTGTCACCAGGG - Intergenic
925990883 2:9253187-9253209 CAGTTTCACTCTTGTCACCCAGG + Intronic
927432493 2:23038943-23038965 CAGTTTCACTCTTGTCACCCAGG + Intergenic
928615434 2:33034000-33034022 CATCTGCTCTCCTGTCCCCCAGG - Intronic
930260454 2:49140235-49140257 CAACAGCTCACTTATCACCAAGG - Intronic
931073361 2:58681305-58681327 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
932359941 2:71096384-71096406 CACAGTCTCACTTGTCACCCAGG + Intergenic
932414605 2:71566035-71566057 CACCTGCTCACATGCCACCTGGG + Intronic
932802755 2:74756359-74756381 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
932924709 2:75959562-75959584 CAGCTGCTTACTTGCCACAATGG - Intergenic
933615702 2:84480456-84480478 CAGCTCCTCACTTGTAAACAGGG + Intergenic
934313333 2:91891527-91891549 CAGTTTCACTCTTGTCACCCAGG - Intergenic
934756389 2:96827602-96827624 CAGCTGCTCACAGGCCACCCGGG + Intronic
935981438 2:108631995-108632017 CAGTTTCCCTCTTGTCACCCAGG + Intronic
936833039 2:116671941-116671963 GAGCTTCACTCTTGTCACCCAGG - Intergenic
937069503 2:119052211-119052233 CAGCTTCTCTCTTGTTGCCCAGG - Intergenic
937123191 2:119454826-119454848 GAGTTCCTCTCTTGTCACCCAGG - Intronic
937215400 2:120309640-120309662 CAGGGTCTCACTTGTCATCCAGG + Intergenic
937428299 2:121817744-121817766 CTGCTGCTCACCTGCCTCCCTGG - Intergenic
937575145 2:123411004-123411026 CAGGGTCTCACTTGTCGCCCAGG + Intergenic
937988727 2:127650456-127650478 CAGCTGCACCCCTGCCACCCAGG - Intronic
938716330 2:134025529-134025551 CAGTTTCGCTCTTGTCACCCAGG + Intergenic
938864300 2:135402610-135402632 CAGTTTCGCTCTTGTCACCCAGG + Intronic
939163843 2:138619039-138619061 CAGCAGCTCCCTTGTCAGCCTGG - Intergenic
940823941 2:158388518-158388540 GAGCTTCACTCTTGTCACCCAGG + Intronic
940846103 2:158643686-158643708 CAGGGCCTCACTTGTCATCCAGG - Intronic
941583453 2:167328836-167328858 CCACGTCTCACTTGTCACCCAGG + Intergenic
941675112 2:168335615-168335637 CAGAGTCTTACTTGTCACCCAGG - Intergenic
943673969 2:190698525-190698547 CAGGGTCTCACTTGTCACCCAGG + Intergenic
944046750 2:195420309-195420331 CAGTTTCGCTCTTGTCACCCAGG - Intergenic
944199429 2:197090515-197090537 CAGAGTCTCACCTGTCACCCAGG + Intronic
944485181 2:200198217-200198239 CAGTTTCACTCTTGTCACCCAGG + Intergenic
946260732 2:218488659-218488681 CAGTTTCGCTCTTGTCACCCAGG + Intronic
946535214 2:220620204-220620226 GAGCTGCTCACCTGTCCCACTGG + Intergenic
946729726 2:222697606-222697628 GAGTTGCACTCTTGTCACCCAGG + Intronic
947356513 2:229301457-229301479 CAGCTGTTTACTTGGCACCCAGG + Intergenic
947511941 2:230763565-230763587 CAGAATCTCGCTTGTCACCCAGG - Intronic
949023992 2:241756545-241756567 CAGTTTCACTCTTGTCACCCAGG + Intronic
1169165842 20:3423322-3423344 CAGCTTCTCACTTGTCAGGTAGG + Intergenic
1169753893 20:9023398-9023420 CAGAGTCTCACATGTCACCCTGG - Intergenic
1170618409 20:17973614-17973636 CAGGGTCTTACTTGTCACCCAGG - Intronic
1171546435 20:26005541-26005563 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1172373018 20:34410347-34410369 CAGAGTTTCACTTGTCACCCTGG - Intronic
1172578925 20:36031393-36031415 CAGCTACTCACTCCTCATCCTGG - Intergenic
1173166099 20:40688285-40688307 CAGCTGCCCACTAGCCACCCCGG - Exonic
1173591812 20:44230728-44230750 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
1173592416 20:44235208-44235230 CAGTTTCTCTCTTGTCACCCAGG + Intergenic
1173593013 20:44240120-44240142 GAGCTTCACTCTTGTCACCCAGG - Intergenic
1173719458 20:45241478-45241500 GAGTTTCACACTTGTCACCCAGG - Intergenic
1173902001 20:46597460-46597482 GAGCTTCACTCTTGTCACCCAGG + Intronic
1173919541 20:46733560-46733582 CAGCTCCTCCCTGGTCTCCCTGG - Intronic
1174047707 20:47745552-47745574 GAGTTTCTCTCTTGTCACCCAGG + Intronic
1174055507 20:47795483-47795505 TCGCTGCCCACTTGGCACCCAGG + Intergenic
1174570071 20:51495108-51495130 CAGCTTCCCACTCATCACCCAGG + Intronic
1174657604 20:52184650-52184672 CAGGGTCTCATTTGTCACCCAGG + Intronic
1175103858 20:56600063-56600085 GAGCTTCACTCTTGTCACCCAGG - Intergenic
1176636490 21:9248647-9248669 TAGAATCTCACTTGTCACCCAGG - Intergenic
1177078836 21:16613428-16613450 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
1177275278 21:18904447-18904469 CACCTGCTCACTGGACACACTGG - Intergenic
1177357710 21:20030911-20030933 CAGTTTCACTCTTGTCACCCAGG + Intergenic
1177795636 21:25776191-25776213 GAGCTTCACTCTTGTCACCCAGG + Intergenic
1178049385 21:28731545-28731567 CAACTGCTCACTTCTAAGCCAGG - Intergenic
1178489311 21:33038450-33038472 CAGTTTCGCTCTTGTCACCCAGG + Intergenic
1178603689 21:34016702-34016724 CAGTTTCACTCTTGTCACCCAGG + Intergenic
1180540076 22:16437402-16437424 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1180832771 22:18914511-18914533 CTGCTGCTCACGCATCACCCGGG + Intronic
1180839207 22:18950995-18951017 GAGCTGCTCACAGGGCACCCGGG - Intergenic
1180849733 22:19010361-19010383 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
1181067094 22:20311888-20311910 CTGCTGCTCACGCATCACCCGGG - Intergenic
1181271201 22:21659641-21659663 GAGCTTCTCTCTTGTCACCCAGG - Intronic
1181550084 22:23632887-23632909 CAGTTGCACCTTTGTCACCCAGG - Intergenic
1181589707 22:23876600-23876622 CAGCTGCTCTCACCTCACCCTGG - Intronic
1181716356 22:24732790-24732812 CAGAGTCTCACTCGTCACCCAGG - Intronic
1182545673 22:31074769-31074791 CAGTTTCACTCTTGTCACCCAGG - Intronic
1183268830 22:36848084-36848106 CATCTGCTCCCTTCTCCCCCAGG - Intergenic
1183960121 22:41406423-41406445 CAGCTGCTCAATTGGCAGCTGGG + Intergenic
1184060088 22:42076321-42076343 GAGTTTCTCTCTTGTCACCCAGG + Intronic
1184134932 22:42542400-42542422 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
1184221731 22:43105087-43105109 CAGTTTCCCTCTTGTCACCCAGG - Intergenic
1184879018 22:47293268-47293290 TAGCTGCTCACCTGTCACCTCGG + Intergenic
1185175883 22:49326315-49326337 GAGCTGCTCACCTGAGACCCTGG + Intergenic
1203282856 22_KI270734v1_random:139815-139837 CTGCTGCTCACGCATCACCCGGG + Intergenic
949871387 3:8592702-8592724 CAGGGACTCACCTGTCACCCAGG + Intergenic
950383148 3:12634578-12634600 CCGGTGCACAGTTGTCACCCAGG - Intronic
951243618 3:20315285-20315307 CAGTTTCTCTCTTGTCACCCAGG - Intergenic
952363539 3:32654403-32654425 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
952802769 3:37312546-37312568 CAGGGTCTCACTTGTCACCTAGG + Intronic
952898714 3:38095963-38095985 CAGCTGCCCACTTCTCATCCAGG - Intronic
953319392 3:41958688-41958710 CAGTTTCACTCTTGTCACCCAGG - Intronic
953757624 3:45660768-45660790 CAGCAGATCAGCTGTCACCCAGG + Intronic
953761652 3:45692347-45692369 CAGGGTCTCACTTGTCACCCAGG + Intronic
953945646 3:47144923-47144945 CAGAGTCTCACTTGTCGCCCAGG - Intronic
953993963 3:47505238-47505260 CAGTTTCACTCTTGTCACCCAGG - Intronic
954286766 3:49625005-49625027 AAGCTGCTCTCTGGTTACCCAGG - Exonic
954779867 3:53051045-53051067 CAGTTTCGCTCTTGTCACCCAGG - Intronic
955005045 3:54960662-54960684 CAGCTGCACTCTTGTCCCCCTGG - Intronic
955331608 3:58051910-58051932 CAGTTTCACTCTTGTCACCCAGG + Intronic
955601858 3:60653993-60654015 CAATAGCTCACTTGTCACCAAGG - Intronic
955949229 3:64225341-64225363 GAGCAGCTGACTAGTCACCCCGG - Exonic
956454118 3:69403921-69403943 CAGGGTCTCTCTTGTCACCCGGG + Intronic
956495370 3:69819937-69819959 CAGAGTCTCACTTGTCACCCAGG - Intronic
956708568 3:72020633-72020655 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
957923885 3:86782600-86782622 CAGCTGCTGATTTGTTACCTCGG - Intergenic
958797285 3:98719172-98719194 CAGTTTCACTCTTGTCACCCAGG + Intergenic
959678857 3:109069128-109069150 CAGAGTCTCTCTTGTCACCCAGG - Intronic
959790204 3:110351351-110351373 GAGCTTCGCTCTTGTCACCCAGG + Intergenic
959794937 3:110415129-110415151 CAGATTCTCAGTTGTCTCCCAGG - Intergenic
959857185 3:111173488-111173510 GAGCTGCTCACTCACCACCCAGG + Intronic
960112168 3:113855677-113855699 CAGAGTCTCACTCGTCACCCAGG - Intronic
960206125 3:114901237-114901259 GAGCCTCTCTCTTGTCACCCAGG - Intronic
960551484 3:118981193-118981215 CAGGTTCTCACTCGTCACCCAGG + Intronic
960847579 3:122018789-122018811 CAGCTGCTCCCTTGTCTCCTTGG - Intronic
961118883 3:124356357-124356379 GAGTTTCTCTCTTGTCACCCAGG + Intronic
961161604 3:124731178-124731200 CAGGGTCTCACTTGTCGCCCAGG - Intronic
961373303 3:126445774-126445796 CAGTTGCTGAGTTGTCCCCCAGG + Intronic
961500836 3:127333681-127333703 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
962582183 3:136808226-136808248 CAGTTTCGCTCTTGTCACCCAGG + Intergenic
963534552 3:146511877-146511899 CAGTTTCACTCTTGTCACCCAGG + Intergenic
964347673 3:155770692-155770714 CAGTTTCTTTCTTGTCACCCAGG + Intronic
964502772 3:157366707-157366729 CAGTTTCACTCTTGTCACCCAGG - Intronic
964721364 3:159769722-159769744 AAGCTTCACTCTTGTCACCCAGG - Intronic
965077165 3:163993714-163993736 CAGGAGCTCACTTATCACCAAGG - Intergenic
965237684 3:166147357-166147379 AAGTTTCTCTCTTGTCACCCAGG + Intergenic
966007748 3:175037189-175037211 CAGCTTCCCACTTGTCCTCCAGG + Intronic
966683655 3:182670494-182670516 CAGTTTCGCTCTTGTCACCCAGG - Intergenic
966711115 3:182973779-182973801 GAGTTTCGCACTTGTCACCCAGG - Intronic
966812257 3:183857221-183857243 CAGCGTCTCACTTGTCACTCAGG - Intronic
967042153 3:185703746-185703768 CAGTTTCTCTCTTGTCCCCCAGG - Intronic
967053413 3:185805795-185805817 GAGCTTCACTCTTGTCACCCAGG + Intronic
968190992 3:196666968-196666990 CAGTTTCGCTCTTGTCACCCAGG - Intronic
968859336 4:3153888-3153910 CAGGGTCTCACTCGTCACCCAGG - Intronic
968909868 4:3472289-3472311 CAGGTGCTCACTCTTCACACAGG - Intronic
969584173 4:8082416-8082438 CCGATGCTCACTGTTCACCCGGG - Intronic
970349921 4:15192072-15192094 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
970589856 4:17550030-17550052 CAGGGTCTCACTTCTCACCCAGG + Intergenic
971713059 4:30141914-30141936 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
973342783 4:49023398-49023420 GAGTTTCTCTCTTGTCACCCAGG + Intronic
974066257 4:57080551-57080573 CAGGATCTCACTTTTCACCCAGG + Intronic
974147975 4:57969477-57969499 CAGGAACTCACTTGTCACCCAGG + Intergenic
976425409 4:84897406-84897428 CAGTTTCACTCTTGTCACCCAGG + Intronic
976995225 4:91423402-91423424 GAGTTTCACACTTGTCACCCAGG - Intronic
977945535 4:102909575-102909597 CAGTTTCACTCTTGTCACCCAGG - Intronic
977958937 4:103062644-103062666 CAGTTTCACTCTTGTCACCCAGG + Intronic
978172155 4:105686086-105686108 CAGTTTCGCTCTTGTCACCCAGG + Intronic
978183561 4:105831908-105831930 CAGTTTCGCTCTTGTCACCCAGG - Intronic
978355339 4:107866538-107866560 GAGCTTCACTCTTGTCACCCAGG - Intronic
978561436 4:110038067-110038089 CAGCATCTCATCTGTCACCCAGG + Intergenic
979199782 4:117963060-117963082 TAGTTTCTCTCTTGTCACCCAGG - Intergenic
980435378 4:132764977-132764999 CAGGGTCTCACTTGTCACCCAGG - Intergenic
981114465 4:140973849-140973871 CAGAGTCTCACTTGTCACCCAGG - Intronic
981124997 4:141095364-141095386 CAGCTGCCCACTCCTCACCCAGG + Intronic
981721824 4:147809572-147809594 CAGCTGGTCACTGGTGACACGGG + Intronic
981722827 4:147818538-147818560 CAGTTTCACTCTTGTCACCCAGG - Intronic
983203512 4:164887635-164887657 GAGTTTCTCTCTTGTCACCCAGG + Intronic
983235979 4:165179509-165179531 GAGTTTCTCTCTTGTCACCCAGG - Intronic
983450579 4:167906455-167906477 CAGAGTCTCACTCGTCACCCAGG + Intergenic
984091981 4:175386710-175386732 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
984329899 4:178300711-178300733 GAGTTTCACACTTGTCACCCAGG - Intergenic
984445367 4:179829861-179829883 CAGCAACTCACTCTTCACCCTGG - Intergenic
984710843 4:182882915-182882937 GAGCTTCACTCTTGTCACCCAGG - Intergenic
985027009 4:185748021-185748043 CAGATGCTCACATTTCTCCCTGG + Intronic
985288818 4:188364951-188364973 CACCTGCTGACTTGTCAGCCTGG + Intergenic
985762079 5:1754380-1754402 CGGAGTCTCACTTGTCACCCAGG + Intergenic
986211073 5:5673050-5673072 CAGAATCTCACTTGTCACCCAGG + Intergenic
987090708 5:14505951-14505973 CATCGGCTCATTTCTCACCCTGG + Intronic
987158421 5:15114800-15114822 CTGCTGCTCAGAAGTCACCCTGG - Intergenic
987616394 5:20279671-20279693 GAGCTTCTCTTTTGTCACCCAGG - Intronic
987723852 5:21671822-21671844 CAGTTTCGCTCTTGTCACCCAGG + Intergenic
987746697 5:21983023-21983045 CATCTGCACAATTGTCAACCTGG + Intronic
987953812 5:24711140-24711162 GAGCTTCCCTCTTGTCACCCAGG - Intergenic
988471657 5:31545082-31545104 CAGTTTCACTCTTGTCACCCTGG + Intronic
989179761 5:38564797-38564819 CAGAGTCTCACTTGTCACCCAGG + Intronic
990111248 5:52327845-52327867 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
990470293 5:56109009-56109031 CAGAGTCTCACTTGTCACCCAGG - Intronic
990470969 5:56115172-56115194 CAGAGTCTCACTTGTCATCCAGG - Intronic
991766869 5:69992783-69992805 CATCTGCACAATTGTCAACCTGG + Intergenic
991846101 5:70867860-70867882 CATCTGCACAATTGTCAACCTGG + Intergenic
992272631 5:75081292-75081314 GAGCTTCGCTCTTGTCACCCAGG + Intronic
992410575 5:76501666-76501688 CAGTTTCACTCTTGTCACCCAGG + Intronic
993392351 5:87335449-87335471 CAGTTTCGCTCTTGTCACCCAGG + Intronic
993564442 5:89455701-89455723 CAGTTTCACTCTTGTCACCCAGG - Intergenic
993831318 5:92762363-92762385 CAGCTGCAAAATTGTCTCCCAGG + Intergenic
993881993 5:93374111-93374133 CAGAGTCTCACTCGTCACCCAGG + Intergenic
994063245 5:95504977-95504999 GAGTTTCTCTCTTGTCACCCAGG - Intronic
994250630 5:97532706-97532728 CAGCCTCGCTCTTGTCACCCAGG - Intergenic
996349400 5:122522178-122522200 CAGAGTCTCACTAGTCACCCAGG + Intergenic
997127859 5:131246426-131246448 GAGCTTCACTCTTGTCACCCAGG - Intronic
997528827 5:134569990-134570012 TCCCTGCTCACTTGTCTCCCAGG + Intronic
997625986 5:135330869-135330891 CAGTTCCTCATTTGTCACTCAGG - Intronic
997970611 5:138398399-138398421 CACCTTCTCACTTGTCTTCCAGG + Intronic
997993439 5:138565737-138565759 CAGGGTCTCATTTGTCACCCAGG + Intronic
998051572 5:139040522-139040544 GAGTTTCTCTCTTGTCACCCAGG + Intronic
998789614 5:145751954-145751976 CAGTTTCACTCTTGTCACCCAGG - Intronic
999199888 5:149808367-149808389 CAGCTGCTCTCTTGACTCTCAGG - Intronic
999290471 5:150422218-150422240 CAGTTTCTCACTTGTCACACAGG + Intergenic
999450980 5:151677950-151677972 CAGTTGTTCACTTGTTCCCCAGG + Intronic
1000488710 5:161881868-161881890 CAGTTTCACTCTTGTCACCCAGG - Intronic
1000849846 5:166326449-166326471 CAGACGCTCTCTTGTCACCCTGG - Intergenic
1001053254 5:168429282-168429304 CAGGGTCTCACCTGTCACCCAGG + Intronic
1001730431 5:173950577-173950599 CAGAGTCTCACTTTTCACCCAGG - Intronic
1001846839 5:174929692-174929714 CAGTTTCACTCTTGTCACCCAGG + Intergenic
1002122608 5:177016995-177017017 GAGGTTCACACTTGTCACCCAGG - Intronic
1002609125 5:180402694-180402716 GAGTTTCGCACTTGTCACCCAGG + Intergenic
1003216315 6:4116323-4116345 CAGAGTCTCACTTGTCACCCAGG - Intronic
1003846528 6:10180048-10180070 CTACTGCTCAATTGTCACCAAGG + Intronic
1003889532 6:10551781-10551803 CAGTTTCGCTCTTGTCACCCAGG + Intronic
1004073104 6:12320330-12320352 CAGTTTCACTCTTGTCACCCAGG + Intergenic
1004659311 6:17696100-17696122 CAGTTTCACTCTTGTCACCCAGG - Intronic
1004720024 6:18260958-18260980 CAAGGTCTCACTTGTCACCCAGG - Intronic
1005220695 6:23585099-23585121 CAGCTTTGCTCTTGTCACCCAGG + Intergenic
1005291966 6:24388639-24388661 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
1005299431 6:24456369-24456391 CAGAGTCTCACTTGTCACCCAGG - Intronic
1005336442 6:24801348-24801370 GAGCTTCACTCTTGTCACCCAGG - Intronic
1005414893 6:25589511-25589533 CAGGGTCTCACCTGTCACCCAGG + Intronic
1006493276 6:34402428-34402450 GAGTTTCTCTCTTGTCACCCAGG - Intronic
1006599854 6:35218145-35218167 CAGCTGCTCACATCTCAAACCGG - Intronic
1007483957 6:42167830-42167852 GAGCTTCACTCTTGTCACCCAGG + Intronic
1007624261 6:43234217-43234239 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1007839940 6:44707847-44707869 CAGCTACACACTTGTATCCCAGG + Intergenic
1009432732 6:63584558-63584580 CAGGATCTCACTTGTCACCCAGG + Intergenic
1009678755 6:66863101-66863123 CAGAATCTTACTTGTCACCCAGG + Intergenic
1010435525 6:75825565-75825587 GAGCTTCACTCTTGTCACCCAGG - Intronic
1010524654 6:76885831-76885853 CTGCTACTCAGTTGTCACCCAGG - Intergenic
1011683943 6:89809189-89809211 CAGTGTCTCACCTGTCACCCAGG - Intronic
1012280332 6:97320940-97320962 CAGAGTTTCACTTGTCACCCAGG + Intergenic
1012475295 6:99609858-99609880 CAGGGTCTCACTTGTCACCCAGG - Intronic
1012497646 6:99852203-99852225 CAGATGCTCACTTGTGCCCCTGG - Intergenic
1012677580 6:102136927-102136949 GAAGTGCTCACTTGTCACCAAGG + Intergenic
1012891619 6:104903713-104903735 AAGTTTCTCTCTTGTCACCCAGG + Intergenic
1013075679 6:106769226-106769248 CAGCATCTCACTCATCACCCAGG + Intergenic
1013223691 6:108103786-108103808 GAGTTTCTCTCTTGTCACCCAGG + Intronic
1014763407 6:125383462-125383484 CAACCGCTCACTTTTGACCCTGG + Intergenic
1015552671 6:134428417-134428439 CAGGTGCTCAATAGCCACCCAGG + Intergenic
1017018990 6:150125198-150125220 AAGTTTCTCTCTTGTCACCCAGG + Intergenic
1017076706 6:150625516-150625538 GAGTTGCACTCTTGTCACCCAGG + Intronic
1017242519 6:152186528-152186550 GAGCTGCTCTCTTGTTGCCCAGG - Intronic
1018031311 6:159844234-159844256 CATCTGCTCACTGTCCACCCAGG - Intergenic
1018223436 6:161604907-161604929 CAGAATCTCACTTGTCGCCCAGG - Intronic
1018285852 6:162236766-162236788 GAGTTTCTCTCTTGTCACCCAGG - Intronic
1018397335 6:163388350-163388372 CCGCTGCTCACTTCCCACCTGGG - Intergenic
1018523410 6:164679079-164679101 CAGAGTCTCACTTGTCACCCAGG - Intergenic
1018659644 6:166074061-166074083 CAGGTGCTCAGCTGACACCCGGG + Intergenic
1018661358 6:166090140-166090162 CAGCAGCTCTCTGATCACCCTGG + Intergenic
1018910471 6:168098509-168098531 CAGCCCCACACTTATCACCCAGG - Intergenic
1019466033 7:1189560-1189582 CAGCGTCTCACTTGTCACCCAGG - Intergenic
1019827479 7:3296466-3296488 CAGAGTCTCACCTGTCACCCAGG - Intergenic
1019964976 7:4491179-4491201 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
1020108617 7:5435130-5435152 CAGGGTCTCACTTGTCACCCAGG + Intronic
1020198673 7:6062438-6062460 CAGGTGATGTCTTGTCACCCTGG + Intergenic
1020226721 7:6286086-6286108 CAGTTTCGCTCTTGTCACCCAGG + Intergenic
1022006537 7:26271087-26271109 CAGTTTCACTCTTGTCACCCAGG + Intergenic
1022456673 7:30564095-30564117 CTGCTGGACACTTGTCAGCCTGG + Intergenic
1022941894 7:35249584-35249606 CAGCAGCTCACCAGGCACCCAGG + Intronic
1023283039 7:38591311-38591333 GAGTTCCTCTCTTGTCACCCAGG + Intronic
1023543307 7:41289403-41289425 CAAGAGCTCACTTGTCACCAAGG - Intergenic
1023803984 7:43858432-43858454 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
1023959351 7:44913674-44913696 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
1024191586 7:47016933-47016955 CAGCGTCTCACTCGTCACCCAGG - Intergenic
1024603739 7:51008675-51008697 CAGCTGCACCCCTGTCCCCCAGG - Intergenic
1024618300 7:51134986-51135008 GAGTTTCTCTCTTGTCACCCAGG + Intronic
1025161015 7:56660762-56660784 GAGTTGCACTCTTGTCACCCAGG - Intergenic
1026090232 7:67293520-67293542 GAGCTTCACTCTTGTCACCCAGG + Intergenic
1026271910 7:68844132-68844154 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
1026433995 7:70377794-70377816 CAGAGTCTCACTTGTCGCCCAGG + Intronic
1026500519 7:70939625-70939647 CAGTTGCACTCTTGTCACCCAGG + Intergenic
1026549004 7:71351113-71351135 CAGTTTCTCTCTTGTCACCCAGG - Intronic
1026916763 7:74124800-74124822 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1027085540 7:75261097-75261119 CAGAATCTCACTCGTCACCCAGG - Intergenic
1027156303 7:75770700-75770722 CAGTTTCTCTCTTGTCACCCAGG + Intronic
1027801416 7:82755874-82755896 CAGCTGCAAACTTGGCACACTGG + Exonic
1027906206 7:84185663-84185685 GAGTTTCTCTCTTGTCACCCAGG - Intronic
1029225049 7:99020067-99020089 CAGATCCTTACTTTTCACCCTGG - Intergenic
1029249296 7:99224504-99224526 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1029298759 7:99561945-99561967 CAGCTGCGCTCTTGACAGCCAGG + Intronic
1029332680 7:99872498-99872520 CATCTGCTAAATTGTCACCATGG + Intergenic
1029724239 7:102391570-102391592 GAGTTTCTCTCTTGTCACCCAGG - Intronic
1030887685 7:114958723-114958745 GAGTTTCACACTTGTCACCCAGG - Intronic
1031520715 7:122761970-122761992 CAGAGTCTCACTTTTCACCCAGG - Intronic
1032023513 7:128423301-128423323 CAGTTTCACCCTTGTCACCCAGG + Intergenic
1032219231 7:129981608-129981630 CAGTTTCACTCTTGTCACCCAGG + Intergenic
1032330789 7:130977164-130977186 AAGTTTCGCACTTGTCACCCAGG + Intergenic
1032427690 7:131834624-131834646 GAGCTGCTCAGCTGTCAACCTGG - Intergenic
1032548552 7:132763201-132763223 CAGCTGCCCACTCCTCTCCCGGG - Intergenic
1032617914 7:133495224-133495246 CAGTTTCGCTCTTGTCACCCAGG - Intronic
1032879973 7:136078309-136078331 GAGTTGCACTCTTGTCACCCAGG - Intergenic
1033379365 7:140798869-140798891 CAGAATCTCACCTGTCACCCAGG + Intronic
1033540377 7:142350443-142350465 CAGCTGCTGATTTATAACCCAGG - Intergenic
1034418172 7:150976011-150976033 CTGCTGCTCACTCGCCAGCCTGG - Intronic
1034488399 7:151380510-151380532 CAGCTTCTCTCCTGGCACCCGGG + Intronic
1034529724 7:151688162-151688184 CCCCTGCTCACTGGGCACCCTGG - Intronic
1034606900 7:152325175-152325197 CAGTTTCTCTCTTGTCGCCCAGG + Intronic
1034631340 7:152532782-152532804 CAGTTTCGCTCTTGTCACCCAGG + Intergenic
1035204213 7:157284279-157284301 CAGCTCCTGACTGGACACCCTGG + Intergenic
1035625901 8:1070326-1070348 CCGCTGCTCACCAGGCACCCGGG - Intergenic
1035715763 8:1753543-1753565 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1035715914 8:1754837-1754859 CAGCTGCTCACCTGGTGCCCTGG + Intergenic
1035868715 8:3113200-3113222 CAGCTCCTCACCTGTCTGCCTGG + Intronic
1036056506 8:5260832-5260854 CAGCTTCTCACTTTGCACTCAGG - Intergenic
1036569722 8:9969566-9969588 GAGCTGCTCAGTTGGCACACAGG + Intergenic
1037278727 8:17211513-17211535 CAGGGTCTCTCTTGTCACCCAGG + Intronic
1037310813 8:17553935-17553957 CAGCTGCTAACTTTTCACTGTGG + Intronic
1037810667 8:22084954-22084976 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
1039047003 8:33459615-33459637 CAGTTTCACTCTTGTCACCCAGG - Intronic
1040000792 8:42575037-42575059 CACGTGGTCACTTCTCACCCAGG - Intergenic
1040120307 8:43676984-43677006 CAGCTTCTTTCTTGTTACCCAGG - Intergenic
1040600570 8:48879646-48879668 TAGAGTCTCACTTGTCACCCAGG - Intergenic
1040643599 8:49371190-49371212 CAGCGTTTCACTTGTCACCCAGG + Intergenic
1041864851 8:62560563-62560585 AAGTTTCTCTCTTGTCACCCAGG + Intronic
1042249743 8:66743975-66743997 CTGCTGCACAGTTGTCATCCTGG + Intronic
1043287691 8:78554596-78554618 CAGCAGCTTACTTTTCATCCTGG - Intronic
1044389786 8:91636335-91636357 CAGCAGCTCATTTGGCAACCCGG - Intergenic
1045002700 8:97892209-97892231 CAGTTTCACTCTTGTCACCCAGG - Intronic
1045527055 8:102949789-102949811 GAGTTTCTCTCTTGTCACCCAGG - Intronic
1046623225 8:116550328-116550350 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
1046899485 8:119508639-119508661 CAGAATCTCACTTGTCACCCAGG - Intergenic
1047841408 8:128757259-128757281 CAGCTTCACTCTTGTCACCCAGG - Intergenic
1048797410 8:138163845-138163867 CAGGGTCTCACCTGTCACCCAGG + Intronic
1050984779 9:12068317-12068339 CACAGTCTCACTTGTCACCCAGG - Intergenic
1051381940 9:16468064-16468086 CAGGTTCTCACCTGTCACCCAGG + Intronic
1052293678 9:26873214-26873236 CAGCTGCTCACTTGTCACCCTGG - Intronic
1053036173 9:34828150-34828172 CAGCTCCCCACTTGTCCCTCTGG + Intergenic
1053408275 9:37896768-37896790 GAGCTTCGCACTTGTCACCCAGG - Intronic
1053484361 9:38440987-38441009 CAGAGCCTCACTCGTCACCCAGG + Intergenic
1054146826 9:61568351-61568373 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1054466565 9:65499404-65499426 CAGTTTCACTCTTGTCACCCAGG - Intergenic
1054896113 9:70313521-70313543 CAGTTTCGCTCTTGTCACCCAGG + Intronic
1055216944 9:73875714-73875736 CAGCTGCACAGTTGCCATCCTGG - Intergenic
1056212758 9:84380638-84380660 GAGTTTCTCTCTTGTCACCCAGG + Intergenic
1057171280 9:92964794-92964816 CAGCCCCTCTCATGTCACCCAGG + Intronic
1057345905 9:94250533-94250555 CAGCAACTCACTTATCACCAAGG + Intergenic
1057518472 9:95741061-95741083 CAGCTGAGCACTTCTCTCCCAGG + Intergenic
1057593185 9:96391589-96391611 CAGCTGCTCAGGCCTCACCCAGG - Intronic
1057739273 9:97697500-97697522 TACCTGCTCTCTTGTCATCCGGG + Intergenic
1058690533 9:107516765-107516787 GAGTTTCACACTTGTCACCCAGG - Intergenic
1059406487 9:114101236-114101258 CAGTTTCTCTCTTATCACCCAGG + Intergenic
1059445669 9:114336490-114336512 AAGCTGGACACATGTCACCCTGG + Exonic
1059655926 9:116357537-116357559 CACCTGCTCTCTTGTCACCATGG - Intronic
1060463175 9:123877794-123877816 GAATTGCTCTCTTGTCACCCAGG - Intronic
1060510386 9:124228142-124228164 CAGTTTCACTCTTGTCACCCAGG + Intergenic
1060932752 9:127499029-127499051 CAGAGTTTCACTTGTCACCCAGG - Intronic
1060953545 9:127621045-127621067 GAGTTTCTCTCTTGTCACCCAGG - Intronic
1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG + Exonic
1061332311 9:129903056-129903078 CAGTTTCACTCTTGTCACCCAGG + Intronic
1061401985 9:130373494-130373516 CAGCTGCTGCCTTGTCACCATGG + Intronic
1061539467 9:131270178-131270200 CAGTTTCACTCTTGTCACCCAGG - Intronic
1061701642 9:132420640-132420662 CAGAGTCTCACTTGTCACCCAGG - Intronic
1062483035 9:136761284-136761306 GAGTTTCTCTCTTGTCACCCAGG + Intronic
1062584403 9:137242460-137242482 CAGCTAATCATTTGTCAGCCAGG - Intronic
1203489750 Un_GL000224v1:92910-92932 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
1203502373 Un_KI270741v1:34796-34818 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
1203719039 Un_KI270742v1:186445-186467 TAGAATCTCACTTGTCACCCAGG + Intergenic
1185516519 X:703097-703119 CAGGTTCTTGCTTGTCACCCAGG + Intergenic
1187096355 X:16152496-16152518 CAGCTGCTCTGTTGCCAGCCTGG + Exonic
1187329117 X:18319569-18319591 CAGAGTCTCACCTGTCACCCAGG - Intronic
1187407170 X:19014656-19014678 CAGAGTCTCACTCGTCACCCAGG + Intronic
1188348594 X:29099124-29099146 CAGTTTCACTCTTGTCACCCAGG - Intronic
1188405879 X:29809121-29809143 CAGTTTCTCTCTTGTCACCCAGG + Intronic
1189440588 X:41032251-41032273 CAGTTTCCCTCTTGTCACCCAGG + Intergenic
1189466127 X:41278913-41278935 CAGAGTCTCACTCGTCACCCAGG + Intergenic
1189807459 X:44750103-44750125 CAGTTTCTCTCTTGTCGCCCAGG + Intergenic
1190852777 X:54262904-54262926 CAGTTTCACTCTTGTCACCCAGG - Intronic
1191666633 X:63709174-63709196 TATCTTCTTACTTGTCACCCAGG - Intronic
1192108806 X:68343246-68343268 GAGCTTCTCTCTTGTCTCCCAGG - Intronic
1192335759 X:70217908-70217930 CAGAGTCTCACTTGTCACCCAGG - Intergenic
1192796698 X:74429444-74429466 CAGGGTCTCACTTGTCACCCAGG - Intronic
1192928315 X:75779254-75779276 CACCTGCTGACTTGCCACTCAGG - Intergenic
1193312647 X:80025822-80025844 CTCCTGCCCACTGGTCACCCTGG + Intronic
1193667890 X:84346207-84346229 CAGGTGCTCACTAGCCACCAGGG - Intronic
1194493600 X:94581057-94581079 GAGTTTCACACTTGTCACCCAGG - Intergenic
1195667883 X:107447343-107447365 CAGTGCCTCACTGGTCACCCAGG + Intergenic
1197053628 X:122091970-122091992 GAGCTTCACTCTTGTCACCCAGG + Intergenic
1197731768 X:129816906-129816928 CAGTTTCACACTTGTCACCCAGG + Intronic
1197924872 X:131635958-131635980 GAGTTACTCTCTTGTCACCCAGG + Intergenic
1199554924 X:149096348-149096370 GAGTTTCTCTCTTGTCACCCAGG - Intergenic
1199776798 X:151019059-151019081 CAGGAGCTCACTTTTCACCCAGG - Intergenic
1199825269 X:151492607-151492629 CAGTTTCGCCCTTGTCACCCAGG + Intergenic
1200075758 X:153549799-153549821 CAACAGCTCACCTGGCACCCTGG - Intronic