ID: 1052294135

View in Genome Browser
Species Human (GRCh38)
Location 9:26878776-26878798
Sequence CTGTCCCCCAAGCTGGAGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12765
Summary {0: 3, 1: 26, 2: 638, 3: 5195, 4: 6903}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052294135_1052294137 24 Left 1052294135 9:26878776-26878798 CCGTACTCCAGCTTGGGGGACAG 0: 3
1: 26
2: 638
3: 5195
4: 6903
Right 1052294137 9:26878823-26878845 AAAATCCAACGCTTTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052294135 Original CRISPR CTGTCCCCCAAGCTGGAGTA CGG (reversed) Intronic
Too many off-targets to display for this crispr