ID: 1052294137

View in Genome Browser
Species Human (GRCh38)
Location 9:26878823-26878845
Sequence AAAATCCAACGCTTTCCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052294136_1052294137 17 Left 1052294136 9:26878783-26878805 CCAGCTTGGGGGACAGAGTGAGA 0: 55
1: 2850
2: 56550
3: 144623
4: 193791
Right 1052294137 9:26878823-26878845 AAAATCCAACGCTTTCCTCTAGG No data
1052294135_1052294137 24 Left 1052294135 9:26878776-26878798 CCGTACTCCAGCTTGGGGGACAG 0: 3
1: 26
2: 638
3: 5195
4: 6903
Right 1052294137 9:26878823-26878845 AAAATCCAACGCTTTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052294137 Original CRISPR AAAATCCAACGCTTTCCTCT AGG Intronic
No off target data available for this crispr