ID: 1052295801

View in Genome Browser
Species Human (GRCh38)
Location 9:26895046-26895068
Sequence GTTTTTAAGGGAATTTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052295801_1052295812 3 Left 1052295801 9:26895046-26895068 CCCACCAAAATTCCCTTAAAAAC No data
Right 1052295812 9:26895072-26895094 TGTCCAAAAACTTACTGGGGAGG No data
1052295801_1052295810 0 Left 1052295801 9:26895046-26895068 CCCACCAAAATTCCCTTAAAAAC No data
Right 1052295810 9:26895069-26895091 CCCTGTCCAAAAACTTACTGGGG No data
1052295801_1052295814 13 Left 1052295801 9:26895046-26895068 CCCACCAAAATTCCCTTAAAAAC No data
Right 1052295814 9:26895082-26895104 CTTACTGGGGAGGTGATTTGAGG No data
1052295801_1052295808 -1 Left 1052295801 9:26895046-26895068 CCCACCAAAATTCCCTTAAAAAC No data
Right 1052295808 9:26895068-26895090 CCCCTGTCCAAAAACTTACTGGG No data
1052295801_1052295806 -2 Left 1052295801 9:26895046-26895068 CCCACCAAAATTCCCTTAAAAAC No data
Right 1052295806 9:26895067-26895089 ACCCCTGTCCAAAAACTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052295801 Original CRISPR GTTTTTAAGGGAATTTTGGT GGG (reversed) Intergenic
No off target data available for this crispr