ID: 1052304679

View in Genome Browser
Species Human (GRCh38)
Location 9:26993783-26993805
Sequence CTAGAGGTATGGATGGAGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052304679 Original CRISPR CTAGAGGTATGGATGGAGCA AGG (reversed) Exonic
900659287 1:3774723-3774745 CTAGAGGTGTGGGTGGGGGAGGG + Intronic
900790002 1:4673605-4673627 TTGGAGGTGTGGAGGGAGCAGGG + Intronic
902087235 1:13873010-13873032 CTAGGGGGATGGAGAGAGCATGG - Intergenic
902709530 1:18229196-18229218 CTGGAGGAAGTGATGGAGCATGG + Intronic
903030450 1:20460267-20460289 ATAGATGGATGGATGGATCATGG + Intergenic
903990274 1:27262778-27262800 CTAGAGGCATGGAATCAGCAGGG + Intronic
904162643 1:28532694-28532716 CCAGAGGCTTGGATGGGGCAAGG + Intronic
904356079 1:29940824-29940846 CAAGAGGGTTGGAGGGAGCAAGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
907858328 1:58325991-58326013 CCAGAGGGAGGGGTGGAGCAGGG - Intronic
908532175 1:65044225-65044247 TTAGAGATATGGATGGGGCTGGG + Intergenic
908967415 1:69782591-69782613 GGAGAGGTATGGATGGAGAAGGG + Intronic
912300385 1:108510042-108510064 CCAGAGTTATAGATGGCGCAGGG - Intergenic
912402392 1:109405911-109405933 CTGGAAGTAGGGATGGAGAAGGG + Intronic
913023445 1:114810200-114810222 CTGGAGATATGGACGGAGCTGGG + Intergenic
916007657 1:160676972-160676994 CTTGAGGGATGGGAGGAGCAGGG + Intergenic
916585872 1:166149779-166149801 CCAGAGGTGGGGATGGAGCATGG - Intronic
916681363 1:167108155-167108177 CTGGATGAATGGATGGACCATGG - Intronic
916714055 1:167435081-167435103 CTGGAGGTAGGGCTGGAGGAGGG - Intronic
917135251 1:171782884-171782906 CTGGAGGTAGGGAAGGAGGAAGG + Intronic
919827527 1:201514037-201514059 CGAGAGATATGAATGGAGAATGG + Intergenic
924665582 1:246068130-246068152 CTGGAGGTATGTTTGGAGGAAGG + Intronic
1064803504 10:19103625-19103647 CTGGAGCTCAGGATGGAGCATGG + Intronic
1068795718 10:61077573-61077595 CTTTAGGTATGGCTGGATCATGG + Intergenic
1068903797 10:62299919-62299941 CTAGACATATAGATGGAGCCTGG + Intergenic
1071304533 10:84286818-84286840 CTGGAGTTAGGGATGGAGTAGGG + Intergenic
1071423994 10:85529787-85529809 CTACAGGGATGGACGGTGCAGGG + Intergenic
1073131707 10:101193251-101193273 CTAGAGGGAAGGCTGGAGGATGG + Intergenic
1073628181 10:105120557-105120579 GTAGAGTTCTGAATGGAGCAAGG - Intronic
1079115301 11:17636760-17636782 CTAGTCCTATGGATGGAGTATGG + Intronic
1079415246 11:20228848-20228870 CCATAGGTATGGACAGAGCAGGG + Intergenic
1079509923 11:21198896-21198918 CAAGAGGTAGGCATGGTGCATGG - Intronic
1080615089 11:33938737-33938759 GAAGAGGTAAGGATGGAGCCAGG - Intergenic
1081547282 11:44080369-44080391 CTTGAGGAGTTGATGGAGCATGG + Intronic
1082760013 11:57118407-57118429 CCAGAGACATGGATGGAGCTGGG + Intergenic
1084594632 11:70109641-70109663 CTAGAGGTAAGGAGGAGGCATGG + Intronic
1085247889 11:75119059-75119081 TAACAGGTATGGAAGGAGCAAGG + Intronic
1087555183 11:99710287-99710309 CAAGAGGAATGAATGGGGCAAGG - Intronic
1088741464 11:112770779-112770801 CTAGAGGGTTGAATGGGGCAAGG - Intergenic
1092404737 12:8211683-8211705 CTGGAGGTATGGATAGAGTCAGG + Intergenic
1095675028 12:44906696-44906718 CTAGAGGAAGAGATGGAGAAAGG + Intronic
1097207311 12:57333721-57333743 CTAGAGGGAAGGAGGGAGGAAGG + Intronic
1097251981 12:57639599-57639621 CTGGATGGATGGATGGAGCCCGG + Intergenic
1099674075 12:85734142-85734164 CTAGAGCTGTGGAGAGAGCATGG - Intergenic
1099983637 12:89636956-89636978 CTAGAGGGAGGAATGGAGCGGGG - Intronic
1102946900 12:116997735-116997757 CTACAGGTATGGTTTCAGCAGGG - Intronic
1103522737 12:121547254-121547276 CTCGAGGTGGGGAGGGAGCAGGG - Intronic
1104680525 12:130748147-130748169 CTGGAGGCCTGCATGGAGCAGGG - Intergenic
1109803188 13:67403320-67403342 TTAGAGGTGTGACTGGAGCAGGG - Intergenic
1112661175 13:101510154-101510176 CTAGAGGAGGGGATGGAGGAAGG - Intronic
1112934159 13:104778392-104778414 CCAGAGGTATGGATGCAGTGTGG - Intergenic
1117602830 14:57391669-57391691 CTATAGGTATAAATGGAGTAGGG - Exonic
1118589716 14:67392428-67392450 CTAGGGGGAAGGAGGGAGCAAGG + Intronic
1118638308 14:67768190-67768212 CTAGGGGTAAGGAGGGAGCATGG + Intronic
1118916533 14:70112169-70112191 CGAGAAGAATGGATGGTGCAAGG + Intronic
1121511364 14:94515435-94515457 CTAGAGGCAGTGAAGGAGCAGGG + Intronic
1122639028 14:103146437-103146459 CTGGAGGCATGGATGGGGAAGGG + Intergenic
1125794044 15:42391523-42391545 CGAGGGGTATGGGTGGAGCCAGG - Intronic
1126439371 15:48671352-48671374 CTACAGGCAGGGATGTAGCAGGG + Intergenic
1126737854 15:51750450-51750472 CCAAAGGGATGGATGCAGCATGG - Intronic
1127863807 15:63015206-63015228 CTAGAGGGGTGGCTGGATCAGGG + Intergenic
1128448451 15:67785635-67785657 CTGGAGGTGTGGAGGCAGCAGGG + Intronic
1128630283 15:69258291-69258313 GTAGAAATATGGATGGAGCGAGG - Intronic
1130547858 15:84869569-84869591 CAAGAGCGATGGTTGGAGCAGGG - Exonic
1130846069 15:87747262-87747284 CATGAGGGATGGATGAAGCAAGG - Intergenic
1131907901 15:97164077-97164099 CTTGAGGTATGGATGGTGCTGGG + Intergenic
1132030902 15:98437928-98437950 ATAGATGGATGGATGGAGGATGG + Exonic
1134689498 16:16182001-16182023 CTGGAGCTATGGATTGGGCAGGG - Intronic
1134804929 16:17116142-17116164 CTAGAGGTAGGATTTGAGCAGGG + Intronic
1134820015 16:17239416-17239438 GTAGATGGATGGATGGATCATGG - Intronic
1137241877 16:46662326-46662348 TTAGAAGTTTGGATGCAGCAAGG + Exonic
1140169770 16:72592458-72592480 GTAGAGGTATGGGAGGAGCAAGG - Intergenic
1143041745 17:4043244-4043266 CTAGAGGTGTTTCTGGAGCATGG + Intronic
1143152693 17:4817079-4817101 CTGGAGGTAGGGAGGGAGCCAGG + Intronic
1144219514 17:13087295-13087317 ATAGGGGTAAGGGTGGAGCAGGG + Intergenic
1144482405 17:15638812-15638834 CTAGAGGTTTGGAGGGAGATGGG + Intronic
1144811412 17:18002263-18002285 CTTGAGGTAGGGATCGAGCCTGG + Intronic
1144916278 17:18726220-18726242 CTAGAGGTTTGGAGGGAGATGGG - Intronic
1146629658 17:34460613-34460635 CAAGAGGTCTGAATGGAGCAGGG + Intergenic
1147425555 17:40344403-40344425 CTAGGGGGATAGTTGGAGCAGGG + Intronic
1151502172 17:74497619-74497641 CAAGAGGTTTGGATGAGGCAGGG + Intergenic
1152841634 17:82572799-82572821 TTAGTGGTAAGGATGGTGCAGGG + Intronic
1158184584 18:54757011-54757033 CTAGAGGTCTGGATAGAGCCAGG + Intronic
1158409629 18:57193980-57194002 CTAGAGGTGGGGATGGGGAAGGG - Intergenic
1160334712 18:78028519-78028541 CTAGAGGAATTGTTGGATCAAGG - Intergenic
1163038106 19:14583299-14583321 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163038795 19:14587556-14587578 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163039541 19:14592223-14592245 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1164741191 19:30576635-30576657 CAGGGGGTATGGATGGTGCATGG - Intronic
1164926847 19:32137379-32137401 CTAGAGGACTGGAGGGAGGAAGG + Intergenic
1167277644 19:48548535-48548557 CTAGATGAATGGATGGAAAATGG + Intergenic
1167675037 19:50878564-50878586 CTAGAGGTAGGGGTGGGACAGGG - Exonic
926808758 2:16737857-16737879 CTTGATGTATAGATGGAGGAAGG - Intergenic
927123001 2:19986029-19986051 CTGGAGCTATAGAGGGAGCAGGG + Intronic
927174185 2:20393836-20393858 CAGCAGGTATGGATGGACCATGG - Intergenic
928207141 2:29293638-29293660 CTAGAAGTAAGAATGTAGCATGG + Intronic
928952626 2:36826510-36826532 CTAGAGGAAAAGAAGGAGCAGGG - Intergenic
931513551 2:63026222-63026244 CTAGAATTATTGATAGAGCAAGG - Intronic
940580920 2:155578945-155578967 CTAGAGGCAGGGAAGGAGAAGGG + Intergenic
942288641 2:174447792-174447814 CTAGAGGTGAGGAGGGAGGAAGG + Intronic
942764881 2:179443318-179443340 CTGGAGGAATGGCTGGAGCCTGG + Exonic
943483048 2:188446000-188446022 CTAGAGGAATGGCTGAAGAATGG - Intronic
1171283990 20:23922873-23922895 CTAGAGCTTGGGATGGAGCCTGG + Intergenic
1173373629 20:42462263-42462285 CTAGAGGGATGAATGGGCCAGGG + Intronic
1173471829 20:43329973-43329995 CAAGAAAAATGGATGGAGCAAGG + Intergenic
1173984497 20:47250554-47250576 CCTGAGGTATGGAGGGAGCAGGG - Intronic
1174075263 20:47930800-47930822 TTAGAGCTATGGATGGCCCATGG + Intergenic
1174187165 20:48714715-48714737 CTTCAGGTATGGCTGGATCATGG - Intronic
1175184971 20:57173911-57173933 CTAGAGGCAAGGATGGCACATGG - Intronic
1175401507 20:58702060-58702082 CAGGAGGTCTGGAAGGAGCAGGG + Intronic
1178678775 21:34653975-34653997 CTAGAGACAAGCATGGAGCAGGG + Intergenic
1178761446 21:35406299-35406321 GTAGAGGTATTGAGGGAGGAGGG + Intronic
1179070667 21:38067960-38067982 CTAGAGCTATTAATGTAGCATGG - Intronic
1179567486 21:42258334-42258356 ATAGAGGGAGGGATGGAGGAGGG - Intronic
1181528283 22:23502301-23502323 ATAGAGGGATGGAGGGATCAGGG - Intergenic
1181977153 22:26738164-26738186 CTATAGGTCTGGGTGGAGCCTGG - Intergenic
1183660310 22:39216177-39216199 CCAGAGGAATGGACTGAGCATGG + Intergenic
1185004380 22:48267127-48267149 CATGAGGTCTGCATGGAGCAAGG + Intergenic
949256788 3:2057803-2057825 CTAGTGGTCTGTATGGAGAAAGG - Intergenic
949514921 3:4798920-4798942 CTGGGGGTAGGGATGGGGCAAGG + Intronic
949845201 3:8362643-8362665 CTAGATGGATGGATGGAGGATGG + Intergenic
952001735 3:28793776-28793798 CTAGATGTAGGGCTGGATCAAGG + Intergenic
952655929 3:35785452-35785474 CTAGAGGAATGGATCATGCACGG - Intronic
953805847 3:46066613-46066635 CTACAGGTCTGGGTGGAGCCTGG - Intergenic
954197020 3:49002958-49002980 CTGGAGAGATGGATGGAGCAGGG - Intronic
955445419 3:59004984-59005006 CAAAAGGTATGGATAGAGTAAGG - Intronic
956487321 3:69736787-69736809 CTTCAGGTATGGTTGGAACAAGG + Intergenic
956580371 3:70805323-70805345 CTAGAGTTATGGAAGGAGGGTGG + Intergenic
962649936 3:137478330-137478352 TTAGTGGTTTGGATAGAGCATGG - Intergenic
962741744 3:138367132-138367154 CTAGGGCTGTGGATGGGGCAAGG + Intronic
963254691 3:143133237-143133259 GTAGAGGTAGGGGTGGAGGAGGG + Intergenic
969600185 4:8171503-8171525 CTTGAGGCAGGGAAGGAGCAGGG + Intergenic
970244397 4:14044229-14044251 CTAGAGGTCTGGAAGGATAACGG - Intergenic
970399737 4:15705684-15705706 CTACAGAAATGGATGGTGCATGG + Intronic
971973444 4:33651643-33651665 CTAGATGTTTGGAAAGAGCAAGG + Intergenic
974545285 4:63298045-63298067 TTAAAGGTATGAATGGAGTAAGG - Intergenic
974615938 4:64282677-64282699 CTAGAGGTGTGGAATGATCAAGG + Intronic
977627838 4:99207429-99207451 TTGGAGGTATGGATGAAGCAGGG - Exonic
978604098 4:110460380-110460402 CTAGAGGTATGGAATGATGATGG + Intronic
979600887 4:122585759-122585781 CTAGATGGATGGATGGAGCATGG + Intergenic
982330324 4:154175208-154175230 CCAGAGGTAAGGATGGAGGGAGG - Intergenic
985193142 4:187399640-187399662 CTAGAGTTCTGGCCGGAGCAGGG - Intergenic
985719637 5:1482430-1482452 CCAGGGGCAGGGATGGAGCAGGG + Intronic
986849122 5:11790391-11790413 ATAGAGGTGTAGATTGAGCATGG + Intronic
986936647 5:12896269-12896291 CTAGAGGGAGGGAGGGAGGATGG + Intergenic
986967243 5:13288711-13288733 GCAGAGGCATGGATGGAGCTGGG - Intergenic
987167693 5:15218593-15218615 CAGGAGGTAAGGATGGAGCCAGG + Intergenic
988623776 5:32849554-32849576 CCAGGGGTAGGGATGGTGCAGGG - Intergenic
988832651 5:35002913-35002935 TGAGAGGCAGGGATGGAGCAGGG + Intronic
989539108 5:42598234-42598256 TTAGAGGTAAGAATGGAGGAAGG + Intronic
995927990 5:117398903-117398925 CTAAAGGCATGGATGAAGCAGGG - Intergenic
996253161 5:121363402-121363424 CTAGAGGTGTGGAGAGAGGAAGG + Intergenic
997488687 5:134254163-134254185 CTAGTGATATGGCTGGAGGATGG - Intergenic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999143169 5:149376279-149376301 CTGGAGGTTTGGATTGGGCATGG + Intronic
999502657 5:152162355-152162377 TGAGAGGTATGGCTGGATCAGGG - Intergenic
999657168 5:153822029-153822051 CCAGAGGTGTGGGTGGGGCAGGG - Intergenic
1000195142 5:158949897-158949919 CTGGAAGTATGGATTGAGCTAGG - Intronic
1001451047 5:171824649-171824671 CCATAGGTATGGGTGGATCATGG - Intergenic
1001657495 5:173363233-173363255 CTGGAGCTTTGGAGGGAGCATGG + Intergenic
1002066101 5:176652485-176652507 CTAAAGGTTTGCATGGAGGATGG + Intronic
1002170154 5:177370462-177370484 CTAGAGGAAGGGATGGAGGGTGG - Intronic
1003972720 6:11314419-11314441 CTAGAAATATGGATGAAGGAAGG + Intronic
1004515365 6:16317810-16317832 TTAGGGGGATGGATGGAGGAAGG - Intronic
1006025331 6:31143180-31143202 CTAGAGGTGTGGAAAGAGGATGG - Intronic
1007603555 6:43099563-43099585 CTAGGGATATAGATAGAGCAGGG + Intronic
1008394839 6:50994325-50994347 CTAGGGGTAGGGAAGGAGGAAGG + Intergenic
1013308563 6:108872461-108872483 CAAGAGGGATGGAGGCAGCATGG - Intronic
1015021437 6:128480480-128480502 GAAGAGGAATGGATAGAGCACGG - Intronic
1016097209 6:140052918-140052940 CTTGAGGTCAGGATGGGGCAAGG - Intergenic
1021101512 7:16589714-16589736 CTAGAGGTATGGATTGAGCCGGG - Intergenic
1022100719 7:27167409-27167431 CTAGAGGAATTTATGGGGCAAGG - Intronic
1023050916 7:36250382-36250404 CTAGAAGGGTGGATGGTGCATGG + Intronic
1024689670 7:51785725-51785747 CTAGAGGGATGGAAGGTGCCAGG - Intergenic
1028168055 7:87562206-87562228 CTAGAGGAATGGGTGGATGAAGG + Intronic
1028614357 7:92748823-92748845 CTATAGGTGTGGATGGGGAATGG - Intronic
1029578094 7:101417280-101417302 CTGGAGGTATGGATGAAGAATGG + Intronic
1029673093 7:102047465-102047487 ATAGAGCTATGGATGGATGAAGG + Intronic
1029673122 7:102047570-102047592 CTAGAGGTAGGGAGGGAGGGAGG + Intronic
1029675361 7:102064823-102064845 CTAGAGGGAGGGAGGGAGCCTGG - Intronic
1030695541 7:112580989-112581011 GTAGAGGACTGGATGGAGCTAGG + Intergenic
1031139556 7:117926954-117926976 CTAGAGGTATGCCTGAAGAAGGG + Intergenic
1034439270 7:151078317-151078339 CGAGAGGGATGGGTGGAGCTAGG + Intronic
1036271484 8:7308169-7308191 CTGGAGGTATGGATAGAGTCAGG - Intergenic
1036349864 8:8002180-8002202 CTGGAGGTATGGATAGAGTCAGG + Intergenic
1036487235 8:9190237-9190259 CTTGAGGAAAGGATGGAGGATGG - Intergenic
1036845137 8:12162710-12162732 CTGGAGGTATGGATAGAGTCAGG + Intergenic
1036866506 8:12405033-12405055 CTGGAGGTATGGATAGAGTCAGG + Intergenic
1037823898 8:22149180-22149202 CTAGGGTTATGGGTGGAACAAGG - Intronic
1038349376 8:26762472-26762494 TCAGAGCTATGCATGGAGCATGG + Intronic
1038666668 8:29543425-29543447 CTAGAGGTTTGGAGGGAGTGTGG + Intergenic
1039034844 8:33348747-33348769 TTAGAGGTATGAAGGGAGCATGG + Intergenic
1039365924 8:36927929-36927951 CTAGAGGGAGGGAGGGAGGAAGG + Intronic
1041720052 8:60967534-60967556 CTTGAGGTGTGGGTGAAGCAGGG + Intergenic
1042786443 8:72551898-72551920 GTAAAGGAATGGATGGAGCTGGG + Intronic
1045024077 8:98070092-98070114 CTAGATGGATGGATGGACCTGGG + Intronic
1045113273 8:98953489-98953511 GTAGGGGTAGGGATGGAGTATGG + Intergenic
1045294904 8:100864136-100864158 TGAGAGGTATGGATGGCGCCTGG - Intergenic
1048346955 8:133583235-133583257 CTTGAGGGCTGGATGCAGCAGGG + Intergenic
1048608956 8:136001067-136001089 TTAGAGGTCTGGATACAGCATGG - Intergenic
1048754507 8:137722049-137722071 CTAGGGGTATGGAAGAAGGAAGG + Intergenic
1051182548 9:14426654-14426676 CTAGAGGAATGGTTGGAGGAAGG - Intergenic
1052304679 9:26993783-26993805 CTAGAGGTATGGATGGAGCAAGG - Exonic
1053011288 9:34635242-34635264 CTAGAGTTAAGGATGGGGGAGGG - Exonic
1055349786 9:75374485-75374507 ATAGGGGTAAGGATGCAGCAAGG + Intergenic
1056300701 9:85237630-85237652 TTAGAGGTAAGGATGAAGGAAGG - Intergenic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1056971371 9:91207385-91207407 CGAGAGGTAGGGCTGGACCAGGG + Intergenic
1057008701 9:91583223-91583245 CTGGATGGATGGATGGAGGATGG + Intronic
1059235312 9:112755723-112755745 CTTCAGGGATGGCTGGAGCAAGG + Intronic
1059529563 9:115023434-115023456 CTAGAGGTGTGTGTGGTGCAGGG + Intronic
1059642358 9:116229751-116229773 CTAGAGGAAGGGAAGCAGCAAGG + Intronic
1060238913 9:121886540-121886562 CTAGAGCTTTGGAGGGGGCATGG + Intronic
1061255819 9:129453814-129453836 ATAGAGGGATGGAGGGATCAGGG + Intergenic
1061678753 9:132232270-132232292 CCGGTGGGATGGATGGAGCAGGG + Intronic
1061947435 9:133916564-133916586 CTGGTGATATGGATGGAGAAGGG + Intronic
1061963165 9:133998453-133998475 GTAGAGGGATGGATGGAGGGAGG - Intergenic
1062715864 9:138009811-138009833 CTGGAGGTGAGGATGGAACAGGG + Intronic
1185645029 X:1610012-1610034 CTGGAGCTTTGGCTGGAGCAGGG - Intergenic
1185645040 X:1610045-1610067 CTGGAGGGTTGGCTGGAGCAGGG - Intergenic
1185645140 X:1610532-1610554 CTGGAGGTTTGGCTGGAGCAGGG - Intergenic
1186993904 X:15099416-15099438 CTAGAGACATGGATGGAGTTTGG - Intergenic
1190384552 X:49872302-49872324 CTAGTGGTGTGGAAGGGGCAGGG - Intergenic
1193588097 X:83352494-83352516 CTAGCTGGATGGATGGAACAAGG - Intergenic
1194781600 X:98030055-98030077 CTAGGGGTATGTATGGTGCGGGG + Intergenic
1195343475 X:103926537-103926559 GTGGGGATATGGATGGAGCAGGG + Intronic
1195363536 X:104106969-104106991 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365036 X:104116914-104116936 GTAGGTATATGGATGGAGCAGGG - Intronic
1195365049 X:104116993-104117015 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365073 X:104117111-104117133 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365093 X:104117191-104117213 GTGGGGATATGGATGGAGCAGGG - Intronic
1195540540 X:106057780-106057802 CTAGACCTACGGAGGGAGCATGG - Intergenic
1195718597 X:107843391-107843413 CTCCAGGGATGGATGGAACATGG + Intronic
1195740545 X:108060888-108060910 CCAGGGGTATGGAGGGAACAGGG - Intronic
1196568919 X:117242999-117243021 ATAGAGGTATTGATGGCACAAGG + Intergenic
1200150129 X:153947241-153947263 CTAGAGGATAGGATGGGGCAAGG - Intergenic